... 2 What is MATLAB ?? Basic Matrix Operations Script Files and M-files Some more Operations and Functions APPLICATIONS: Plotting functions .. ... Vectors are special forms of matrices and contain only one row OR one column. Scalars are matrices with only one row AND one column MATLAB Matrices 17 A matrix with only one row AND one column is a scalar. A scalar can be created in MATLAB as follows: » a_value=23 a_value = 23 MATLAB Matrices 18 A matrix with only one row is called a row vector. ...

Еще в разделе: (Показать все результаты (>14) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.su/~yurin/Doxyfile

... Physics Department . Russian Academy of Sciences . ... www.utro-russia.ru , 08 December 2010, Lotus effect will make flights safer (in Russian). ... Vesti.Ru , 25.08.2009, A sacred flower has helped Russian scientists . ... Akado , 08.08.2008 Polymers surround us , in Russian. ... International weekly journal of science Nature , 25.06.2009, Sodium salts in E-ring ice grains from an ocean below the surface of Enceladus . Top News , 25.06.2009, Saturn's moon Enceladus may host a salty ocean . ...

Еще в разделе: (Показать все результаты (>315) - polly.phys.msu.ru/ )

• Scientific
• Recent selected publications
• State prize - Chair of Polymer and Crystal Physics

ВМиК-Online! ... Факультет . ... Абитуриенты . ... Вариант письменного вступительного экзамена . по английскому языку . Отделение бакалавров факультета ВМиК . ... They found that cannabis users are 40 percent less effective in fighting viruses than normal people. ... Группа В Контакте для абитуриентов ВМК МГУ: . Поступление на ВМК МГУ 2012 . Форум абитуриентов ВМК МГУ . ... Телефон приемной комиссии факультета ВМиК МГУ: . ... 2001 2012 ВМиК Online! ...

Еще в разделе: (Показать все результаты (>10) - www.cmc-online.ru/ )

• ВМиК - Online! : Работа для выпускников и студентов ВМК МГУ - Вакансии компании
• ВМиК - Online! : Новости - На факультете ВМиК началась неделя GraphiCon?2003
• ВМиК - Online! : Работа для выпускников и студентов ВМК МГУ - Kelly Services

sparallel.ru . Older posts . Newer posts . Posted by admin . ... Continue reading . Posted in Разное . Мар 17 . ... В интернет-магазине Cityboots представлена последняя коллекция обуви от Fabi по доступной цене. ... Posted in Ботинки . ... Широко известный канадский бренд бюджетной мужской и женской обуви. ... Posted in Кросовки . ... Posted in Сандалии . ... совокупный доход, получаемый этими ?обуви? или ? ... Экологически чистая обувь, обувь которая ?дышит? ? ... обувь изо льна. ...

Еще в разделе: (Показать все результаты (>14) - sparallel.ru/ )

• sparallel.ru - Part 106

CURRICULUM VITAE SERGEY BALAKHONOV Lomonosov Moscow State University (MSU) Department of Materials Science , Inorganic Chemistry Division Laboratory MSU, Leninskie Gory 1/3, GSP-1, Moscow , 119991, Russia Name Born Nationality Age Marital state Home address Phone number Fax number E-mail Web Sergey Balakhonov 26.09.1987 in Bryansk, Russia Russian Federation 23 years old Unmarried 119991, ... Hydrothermal / solvothermal and hydrothermal-microwave synthesis. ...

Еще в разделе: (Показать все результаты (>78) - www.inorg.chem.msu.ru/ )

• Inorganic Chemistry Division
• Index of /matsci
• Index of /matsci/rus

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ HYDROACOUSTIC ANTENNA : A POWERFUL TOOL TO FORECAST TSUNAMIGENIC EARTHQUAKES Yakov S. Karlik Central Research Institute MORPHYSPRIBOR , 46 Chkalovsky proezd, Sankt-Petersburg, 197378 Russia E-mail: karlik@mail.cl.spb.ru ABSTRACT Hydroacoustic antenna ... 2001). ... Eiby, J.A., 1982: Earthquakes. ...

Еще в разделе: (Показать все результаты (>26) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E12_Marchuk.pdf
• http://seac47-2.phys.msu.ru/proc/E10_Kong.pdf
• http://seac47-2.phys.msu.ru/proc/E16_Nosov_Skachko.pdf

Name Last modified Size Description . Parent Directory - On Fredholm representations of discrete groups.pdf 23-Oct-2007 09:15 350K . Apache/2.2.10 (Linux/SUSE) Server at higeom.math.msu.su Port 80

Еще в разделе: (Показать все результаты (>311) - higeom.math.msu.su/ )

• Index of /people/ssmirnov/pics/jdm/Spain
• Index of /people/ssmirnov/pics/jdm/France
• Index of /people/talalaev

CRIMEAN FIELD GEOLOGICAL CAMP, FIRST YEAR (1st CRIMEAN) . First Crimean Field Camp is organized for the MSU Geological Faculty first year students. ... Professors and researchers from Dynamic Geology Department of Geological Faculty and Russian Academy of Science Institute of Geology are leadind the students. ... SHORT HISTORY OF THE 1st CRIMEAN . ... The main goal of the field camp is to show students how geological processes work now and what we can learn about them in the past. ...

Еще в разделе: (Показать все результаты (>23) - dynamo.geol.msu.ru/ )

• http://dynamo.geol.msu.ru/docs/PHD-25_00_03.pdf

My Teachers . Kh.A. Rakhmatulin . ... U.M. Dubova-Sergeeva . ... Kh.A. Rakhmatulin's works reflect a wide range of his scientific interests. Fundamental results, obtained by him, have a great scientific and applied significance in many fields of modern mechanics: . ... Meritorious Art Worker of Russia Undina Mikhailovna Dubova-Sergeeva was founder and head of M.Lomonosov Moscow State University Piano Class, from 1936 till 1986. ...

Еще в разделе: (Показать все результаты (>6) - margaret.imec.msu.ru/ )

... Форумы > Разное > Тема . ... Работа в Microsoft . ... Резюме на английском можно направлять по адресу uwork@microsoft.com В Москве интервьюировать будут в конце Мая. ... Hа конкретные вопросы могу попробовать ответить по . ... Если этот этап пройден, то как правило назначают телефонное интервью. ... Ответить Цитировать . ... Someone that is very driven and passionate about technology, desiring to make software products that will go all over the world . ... Работа в Microsoft - 2005 . ...

Еще в разделе: (Показать все результаты (>275) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | PhD position in the University of Florida
• MMOnline | Резюме номер 1061
• MMOnline | Форумы | Аспирантура | Аспирантура в Порту, Португалия

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>22) - mouse.genebee.msu.ru/ )

• ConClus

www.elsevier.nl/locate/ica Inorganica Chimica Acta 305 (2000) 1 ­ 6 Increased catalytic activity of primary amine palladacycles in biomimetic hydrolysis of N -t-BOC -S -methionine p -nitrophenyl ester Sergey A. Kurzeev a, Gregory M. Kazankov a, Alexander D. Ryabov a a,b, * Department of Chemistry, M.V. Lomonoso6 Moscow State Uni6ersity, 119899 Moscow, Russia b G.V. Plekhano6 Russian Economic Academy, Stremyanny per. ... Keywords: Kinetics; Hydrolysis; Palladium complexes; Cyclometalated complexes 1. ...

Еще в разделе: (Показать все результаты (>162) - www.enzyme.chem.msu.ru/ )

• http://www.enzyme.chem.msu.ru/ryabov/pdf/AC_00.pdf
• Recent reports on conferences

Pipe Line Filtering Dmitry V. Yurin Moscow State University, Faculty of Computational Mathematics and Cybernetics, Lab. of Mathematical Methods of Image Processing. yurin_d@inbox.ru Abstract A unified template C++ library is proposed for image filtering by local environment. ... It makes easy to combine filters and transfer output of filters to input of others. ... Otherwise, each filter one time should process input and output lines with the same relative numbers in the images. ...

Еще в разделе: (Показать все результаты (>193) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2008.cyprus.yurin_kravtsov.scripting.en.pdf
• http://imaging.cs.msu.ru/pub/2011.Graphicon.Zipa_Ignatenko.MetallicCoating.en.pdf
• Basic edges | Laboratory of Mathematical Methods of Image Processing

... Conference Venue . ... Let me thank you from the very bottom of my heart for your support, friendship and cooperation in making to a real success the First international conference on humic innovative technologies entitled Natural and Synthetic Polyfunctional Compounds and Nanomaterials in Medicine and Biomedical Technologies (HiT-2010), which took place on November 4-8, 2010 at the Lomonosov Moscow State University, Moscow, Russia. ... As a total, the conference was full of events. ...

Еще в разделе: (Показать все результаты (>176) - mgumus.chem.msu.ru/ )

• MGUMUS -- Irina V. Perminova

... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...

Еще в разделе: (Показать все результаты (>1587) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-1.pdf
• Search Results п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°

. Name . Last modified . Size . Description . Parent Directory . - . 2014 2015/ . 18-Dec-2014 09:26 . - . 2015 2016/ . 09-Feb-2016 14:24 . - . About Lab/ . 20-Apr-2011 14:58 . - . Anketa/ . 14-Apr-2015 09:59 . - . Apache/2.2.3 (CentOS) Server at jaffar.cs.msu.ru Port 80

Еще в разделе: (Показать все результаты (>12) - jaffar.cs.msu.ru/ )

• Index of /mash/os/About Lab
• Index of /mash
• Index of /mash/os/2014 2015/Коллоквиум

. Name . Last modified . Size . Description . Parent Directory . - . 2014 2015/ . 18-Dec-2014 09:26 . - . 2015 2016/ . 09-Feb-2016 14:24 . - . About Lab/ . 20-Apr-2011 14:58 . - . Anketa/ . 14-Apr-2015 09:59 . - . Apache/2.2.3 (CentOS) Server at jaffar.cs.msu.su Port 80

Еще в разделе: (Показать все результаты (>12) - jaffar.cs.msu.su/ )

• Index of /mash/os/About Lab
• Index of /mash
• Index of /mash/os/2014 2015/Коллоквиум

. Name . Last modified . Size . Description . Parent Directory . - . operating_systems.ppt . 2011-03-21 02:27 . 218K . presentation-3.ppt . 2011-03-14 02:45 . 53M . questions_2011.doc . 2011-03-23 15:27 . 26K . translators.ppt . 2011-03-14 02:43 . 296K . Apache/2.4.10 (Debian) Server at asvk.cmc.msu.ru Port 80

159. Index of /tomilin

---

Астронет | Научная сеть | ГАИШ МГУ | Поиск по МГУ | О проекте | Авторам

Комментарии, вопросы? Пишите: info@astronet.ru или сюда