e-mail: andreymestnikov@mail.ru) , , , , government, innovation policy, Symbolic capital, symbolic capital investment . In this article the question of investment of symbolical capital within the state innovative policy is considered. The state as a source of this kind of capital invests it in various economic institutes in particular in the venture investment institute (venture funds). ...

Еще в разделе: (Показать все результаты (>57) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2010/2/07.pdf
• http://www.socio.msu.ru/vestnik/archive/2011/4/03.pdf
• http://www.socio.msu.ru/vestnik/archive/2012/3/05.pdf

... Rod unfortunately was not able to come to Garmisch this year, but has been in touch with the Russian Internet community in Seoul, Sharm el Sheikh, Nairobi, and the United States, and has sent a special letter to Vladislav Petrovich. ... ICANN is working with regional associations and the Internet Society in a global training program that is raising the security awareness and skills of those DNS operators in regions where resources for such training are limited. ...

Еще в разделе: (Показать все результаты (>7) - www.iisi.msu.ru/ )

• http://www.ipib.msu.ru/UserFiles/File/spconf2010/talks/requena.doc

... About 70 scientific papers. The theory of square parachute is created, describing distribution of parameters of shape, tension and resistance to airflow of canopy in steady-state condition for various sets of suspension line lengths and air-permeability. ... The practical recommendations for optimal parachute application are submitted. ... It is discovered experimentally that a character of pressure distribution for a square canopy depends on a particular choice of suspension line lengths. ...

Еще в разделе: (Показать все результаты (>11) - margaret.imec.msu.ru/ )

• Homepage
• Education

PhD Summer School on Scentific Computing . ... Paula Carroll, University College, Dublin, Ireland . ... Irina Fedulova and Sergey Pevtsov, Moscow State University, Russia . ... John Houlihan, Waterford Institute of Technology, Ireland . ... Jimmy McGibney, Waterford Institute of Technology, Ireland . ... Micheal O hEigeartaigh, Waterford Institute of Technology, Ireland . ... Paul O'Kelly, Waterford Institute of Technology, Ireland . ... Michael Ryan, Waterford Institute of Technology, Ireland . ...

Еще в разделе: (Показать все результаты (>39) - angel.cs.msu.su/ )

• Foreword

Tatiana V. Salnikova . NAME: Tatiana V. Salnikova DATE OF BIRTH: June 28, 1960 CITIZENSHIP: Russian PROFESSIONAL AFFILIATION: Moscow State University, Department of Mathematics and Mechanics OFFICE ADDRESS: Tatiana V. Salnikova, Moscow State University Dept. of Maths. Mechanics, Theoretical Mechanics and Mechatronics Leninskie Gory Moscow 119992 Russia E-mail: tatsalni@mech.math.msu.su HOME ADDRESS: Tatiana V. Salnikova Litovski street 5/10, apt. ...

Еще в разделе: (Показать все результаты (>3) - www.theormech.math.msu.su/ )

• Alexandra A

... Subject : NEW FARM RESOLUTION (From RUSAG conference) . ... This material is from RUSAG conference. ... First, as Deputy Prime Minister Alexander Zaveryukha noted, the government is sticking to its plan to spend the 13.1 trillion rubles already allocated in the farm budget for 1996. ... In addition, the authors of the resolution argue, that with increased government backing, farmers will be able to produce 9 million tons of meat and chicken, 34 million tons of milk, and 32 billion eggs. ...

Еще в разделе: (Показать все результаты (>252) - www.fadr.msu.ru/ )

• Abstracts
• Created with DiDa
• anons2_e

... Denis G. Gusev . ... M.S., Physics, Moscow State University, 2004, with honor . Second- and third-harmonic generation in coupled microcavities based on all-silicon photonic crystals", PDF . ... Dr. T.V. Dolgova . ... Dr. A.A. Fedyanin . ... D. G. Gusev , I. V. Soboleva, M. G. Martemyanov, T. V. Dolgova, A. A. Fedyanin, O. A. Aktsipetrov, "Enhanced second-harmonic generation in coupled microcavities based on all-silicon photonic crystals", Phys. Rev. B 68 , 233303 (2003). ... 5, 677 (2004). ...

Еще в разделе: (Показать все результаты (>41) - shg.phys.msu.ru/ )

• Nick's Homepage
• TATIANA VLADIMIROVNA MURZINA

... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . ... Department seminar . ... Vladimir Andreev , Moscow State University, Russia . ... Vera Beloshapko , Moscow State University, Russia . Alexander Belov , Moscow State University, Russia . Inna Belukhina , Moscow State University, Russia . Igor Blatov , Povolzhsky State University of Telecommunications and Informatics, Russia . ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>9) - math.phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Moscow State University Russian Language Centre . Moscow State University . ... Learn Russian at the Moscow State University! ... 28.05.2004 . New full on-line Russian language reference on our website! (more.. ... On April, 29, 2004 the rector of the Moscow M.V.Lomonosov State University academician V.A.Sadovnichy signed the order on creation of the Moscow school of economy of the Moscow M.V.Lomonosov State University. (more.. ... Space tourist calls Russian language his greatest challenge . ...

Еще в разделе: (Показать все результаты (>24) - www.rlcentre.com/ )

The files containing information about Affymetrix microarrays were downloaded from the official Affymetrix site. ... Probe sequences were mapped to the genome using Blat. ... The hits found "probe alignment regions" were . ... We annotated each probe alignment region using the mRNA and EST alignments provided by UCSC, considering only . ... The textual part of the interface consists of probe information section, probe alignment section and transcription state . ... Each gene and each probe alignment . ...

Еще в разделе: (Показать все результаты (>6947) - mouse.belozersky.msu.ru/ )

... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...

Еще в разделе: (Показать все результаты (>7) - depository.msu.ru/ )

... 2004). Our attempt to increase the yield in the reaction of O-methylation (Albov, Rybakov et al., 2004), using excess methyl iodide, caused the subsequent methylation at the N atom and led to the title compound, (2) (Fig. ... C10H13NO DOI: 10.1107/S1600536804010025 Acta Cryst. ... ORTEP 3 (Farrugia, 1997) view of (2), with the atom numbering scheme. ... Acta Cryst. ... Farrugia, L. J. (1997). ... Cryst. ... In (2), H atoms were included in calculated positions and re®ned as riding atoms. ...

Еще в разделе: (Показать все результаты (>169) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/101e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/030e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/114e.pdf

MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...

Еще в разделе: (Показать все результаты (>86) - brain.bio.msu.ru/ )

• Sergei Shishkin * Сергей Шишкин
• Conclusion
• Change-points in EEG components with different pattern

SCALE-SPACE METHOD OF IMAGE RINGING ESTIMATION Andrey V. Nasonov, Andrey S. Krylov Lab. of Mathematical Methods of Image Processing, Faculty of Comp. ... Ringing effect (Gibbs phenomenon) appears in images as oscillations near sharp edges. ... One of the main problems of image deringing is to detect the presence of ringing effect and to estimate the necessary ringing suppression level. ... T V values of edges with ringing artifacts are greater than T V values of edges without ringing effect. ...

Еще в разделе: (Показать все результаты (>561) - imaging.cmc.msu.ru/ )

• Laboratory of Mathematical Methods of Image Processing
• View publication | Laboratory of Mathematical Methods of Image Processing
• Image resampling and superresolution | Laboratory of Mathematical Methods of

... Conference venue . Moscow, Russia . ... Housing and Travel . The ICONO/LAT 2013 conference is served by the UniFest--professional, conferences management company, who provides hotel accommodation and travel assistance to the conference participants. ... Description: The Korston Hotel Moscow is the flagship of the Korston Hotels & Malls brand and is today one of the best hotels in Moscow. ... The Korston Hotel Moscow offers elegantly furnished rooms with a fabulous panoramic view of Moscow. ...

Еще в разделе: (Показать все результаты (>14) - iconolat13.phys.msu.ru/ )

• Invited speakers
• Submit a paper

Curriculum Vitae . ... Degree: candidate of science in mathematics and physics (PhD), obtained from Lomonosov Moscow State University (2006) . ... 2003 - 2006 . Lomonosov Moscow State University , Faculty of Computational Mathematics and Cybernetics . ... Lomonosov Moscow State University , Faculty of Physics . ... Kurchatov student scholarship at Lomonosov Moscow State University . ... Young Scientists Summer Program at International Institute for Applied System Analysis ( Laxenburg , Austria ) . ...

Еще в разделе: (Показать все результаты (>7) - oc.cs.msu.ru/ )

Bedlewo Conference Center is located near Poznan. ... There will be a bus connection from Poznan train station "Poznan Glowny" to Bedlewo. ... Bus departure at 8:00 pm. (after arrival of the trains from Warszawa at 7:12pm, and from Berlin at 7:42 pm) . ... Getting to Bedlewo on your own is possible: you will have to take a train from Poznan to Mosina, and then 13 kilometers by taxi. ... If you plan to arrive to Warsaw airport you can reach the train station "Warszawa Centralna" by bus No 175. ...

Еще в разделе: (Показать все результаты (>154) - higeom.math.msu.su/ )

• C*-algebras and index.II: Arrival
• Mishchenko Alexandr S.
• Publications of E.A.Morosova

SUNY-MSU Partnership . ... MSU | ... The State University of New York/Moscow State University partnership dates back to the mid-1970s and owes its existence to the vision of then MSU Rektor Rem Kokhlov and SUNY Chancellor Ernest L. Boyer. ... The first students were exchanged in 1977. ... A SUNY Center on Russia and the United States opened its doors in January 2000, and a sister MSU Center on the United States and Russia was set up in Moscow at MSU?s newly built Science Park. ... suny-msu . ...

Еще в разделе: (Показать все результаты (>2) - www.suny.msu.ru/ )

• SUNY-MSU: Center on Russia and the United States

... 1 Leninskiye Gory, Building 2, Room N8, CEDEX-1, Moscow, Russia 119991 . Moscow, ?Universitet? metro station (red line), intersection of Lebedeva street and Lomonosov avenue, Faculty of Physics, additional storey. ... From the security booth you have to call a lab employee awaiting you so he could fetch you to the lab. Citizens of other countries must get an additional permit to enter MSU buildings. ...

Еще в разделе: (Показать все результаты (>33) - engineering.phys.msu.ru/ )

• Russia Today channel about us