... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...
... Mathematical Theory of Feedback Control . ... Annotation: this course is about mathematical equations of atmospheric diffusion which allow modeling of the problems of environment. ... The course reflects the experience and the point of view of a research group in the field of mathematical modeling of Western, Soviet and later Russian economics. ... Such approach captures the behavior of rather complex systems. ... Scientific Seminar: Mathematical Modeling of Complex Systems . ...
... О UNИX . ... ApacheWithModPython . ... Why Use mod_python . ... The sample configurations below are for a wiki instance called mywiki installed in a directory /var/www/moin/mywiki with the main MoinMoin installation installed in python's default site library path. ... Add a Location directive: <Location /mywiki> SetHandler python-program # Add the path of your wiki directory PythonPath "['/var/www/moin/mywiki'] + sys.path" PythonHandler MoinMoin.request.request_modpython::Request.run </Location> . ...
University Satellites and . Space Science Education . ... A SERIES OF ATLASES ON METHODS OF SPACE IMAGES INTERPRETATION AS A NEW TOOL FOR REMOTE SENSING EDUCATION IN EARTH SCIENCES . ... Special manuals in the form of atlases of satellite images and their interpretation results are within the best tools for support of the geographical and ecological research and thematic mapping. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...
... Issues of the year 2010 . ... Instructions for Authors . ... The scientific English language journal ‘GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY’ aims at informing and covering the results of research and global achievements in the sphere of geography, environmental conservation and sustainable development in the changing world. ... In the text the surname of the author and the year of publication of the reference should be given in square brackets, i.e. [Author1, Author2, 2008]. ...
... Integrability of the Problem of the Motion of a Cylinder and a Vortex in an Ideal Fluid A. V. Borisov and I. S. Mamaev Received July 4, 2002 Abstract--In this paper, we obtain a nonlinear Poisson structure and two first integrals in the problem of the plane motion of a circular cylinder and n point vortices in an ideal fluid. ... 1 2004 (4) MATHEMATICAL NOTES MOTION OF A CYLINDER AND A VORTEX IN AN IDEAL FLUID 21 generating (by the structure (3)) the symmetry field vF = 2(v2 , -v1 ,y , -x). ... 1...
[
Текст
]
Ссылки http://ics.org.ru/upload/iblock/c44/129-an-integrability-of-the-problem-on-motion-of-cylinder-and-vortex-in-the-ideal-fluid_ru.pdf -- 91.4 Кб -- 28.10.2015 Похожие документы
... Many presentations concern interesting work, but are nevertheless difficult to follow because the speaker unknowingly makes a number of presentation errors. ... Time 1 Conclusion Audience Attention Introduction Various Themes Efficient Presentation Intermediate Conclusion Intermediate Conclusion Average Presentation Figure 2 Ideal attention curve of an audience when the speaker divides his talk in recognizable parts, each summarized by intermediate conclusions. ... What is a successful poster? ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
3D Simulation of Stress - strain State in Pneumatic Tires. ... Moscow State University, Russia . Section 1.1 . ... Mechanical model for computation of Stress - strain State in pneumatic tires. ... Numerical simulation of axisymmetrical Stress - strain State in tires. ... Axisymmetrical Stress - strain State in tire. ... Numerical simulation of 3D Stress - strain State in tires . ... Solution of contact problem on tire contacting rigid surface in view of friction on contact surface. ...
МГУ имени М.В.Ломоносова Русская версия . ... Section ?Psychology? ... 29 Feb 2016 . ... 15 Apr 2016 . ... Chair Yury P. Zinchenko, professor, Dean of the Faculty of Psychology MSU . ... Chair Yury P. Zinchenko, Dean of the Faculty of Psychology MSU, academician RAE . ... A.G.Asmolov chair of the department of Personal Psychology, academician RAE; . ... B.S.Bratus chair of the department of General Psychology, corresponding member RAE; . ... Actual problems of sport psychology and healthy lifestyle. ...
... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...
Lomonosov Moscow State University was established in 1755 . ... Lomonosov Moscow State University Diary . ... MSU Web Sites . ... General Information . ... Study and Research . ... MSU Online . ... Research Priorities in Sciences at MSU: . ... MSU-RAS Research Institute of Soil Science . ... Research Priorities in Humanities at MSU: . ... Research Priorities in Social Sciences at MSU: . ... Research Priorities in the Humanities at MSU: . ... Research Priorities in Sciences and Humanities at MSU: . ...
... О факультете | ... Структура факультета . ... Тина Канделаки и Маргарита Симоньян станут ведущими нового ток-шоу Железные леди на НТВ. ... Бывшая ведущая канала Наталья Метлина заявила, что программа с участием Канделаки и Симоньян заменит в эфире ее шоу 'Метла'. ... Виталий Третьяков считает, что телевидение должно иметь 'книжный фундамент', то есть опираться на традиционные культурные ценности человечества.. ... 2009-2014 Высшая школа телевидения МГУ им. М.В.Ломоносова . ...
Title Should Be in Bold, 18-Point Type and Centered, Please Use Title Case Author name(s) [10-point type, centered, bolded] Author affiliation and full address (8-point type, centered, italicized) Author e-mail address: (8-point type, centered, italicized) Abstract: Indent left and right margins 0.5 in. (1.27 cm), justify the paragraph (on both right and left), and use the same font as in the body of the paper. ... 5] Author(s), "Title of paper," in Title of Proceedings, Name(s), ed(s)., ...
[
Текст
]
Ссылки http://iconolat13.phys.msu.ru/ICONO_LAT-2013/Guidelines_files/Meetings-Style-Guide.pdf -- 128.6 Кб -- 26.01.2013 Похожие документы
... Rete 1. Forgy, Charles L. "Rete: A Fast Algorithm for the Many Pattern/Many Object Pattern Matching Problem." Artificial Intelligence, Vol. 19, ? ... Proceedings of the Fifth National Conference on Artificial Intelligence, AAAI, Philadelphia, 1986, pp. ... Scales, D. "Efficient matching algorithms for the SOAR/OPS5 production system." ... Proceedings of the Sixth IEEE Conference on Artificial Intelligence Applications, 1990, pp. ... TREAT: a better match algorithm for AI production system." ...
Transhumus : Integrated software solution for interpretation of FT-ICR mass spectra of natural organic matter Anton Grigoryev1, 2, Alexey Kononikhin 1 2 2, 3 , Irina Perminova4, Eugene Nikolaev2, 3 ansgri@gmail.com Institute for Energy Problems of Chemical Physics, Moscow , Russia 3 Institute of Biochemical Physics, Moscow , Russia 4 Lomonosov Moscow State University, Moscow , Russia Natural organic matter ( ... However, there still are problems with interpretation of mass spectra of NOM. ...
[
Текст
]
Ссылки http://www.mgumus.chem.msu.ru/publication/2010/2010-grigoryev-transhumus.pdf -- 315.1 Кб -- 26.11.2010
[
Текст
]
Ссылки http://mgumus.chem.msu.ru/publication/2010/2010-grigoryev-transhumus.pdf -- 315.1 Кб -- 26.11.2010 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...
... This is so elementary it hardly needs comment . ... Единица (меньше единицы по модулю) . ... Group unit element . ... Единичная геометрическая краткость . ... Unit normal . ... Let $v$ be a vector of unit length . Единичный вектор внешней нормали . Unit outer normal vector . Outer normal unit vector . Единичный вектор восходящей нормали . ... Единичный вектор касательной . ... Единичный вектор направления движения . ... Normal unit vector . Unit normal vector . ... One component . ...