... Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ­ Institute for Biomedical Problems, Russian Academy of Science invite you to take part in "VI Russian National School with International Participation on Muscle and Exercise Physiology "Systemic and cellular mechanisms in physiology of motor system". ... We invite scientists, post-grade students, residents and students to take part in School on systemic and cellular mechanisms in physiology of motor system. ...

Еще в разделе: (Показать все результаты (>19) - fbm.msu.ru/ )

• Факультет фундаментальной медицины МГУ

Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics , DEPNI . ... Team . ... Doctor of Science, Professor, Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics . ... PhD, Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics . ... PhD, Lomonosov Moscow State University, Physics Faculty . ... Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics . ... Physics Department, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>46) - cdfe.sinp.msu.ru/ )

• CDFE ? NEA DB

Research topics . ... This group is formed to study the reactions at semiconductor surfaces. ... Group members: . ... M.V. Lomonosov Moscow State University: . ... Dr. Tatiana S. Zyubina, senior scientific researcher (quantum chemical modeling) . ... Joint Semiconductors Surface Study group: research sketches . The Joint Semiconductors Surface Study (JSSS) group was developed on the base of Inorganic Chemistry division, Chemistry dept. of M.V. Lomonosov Moscow State University. ...

Еще в разделе: (Показать все результаты (>53) - www.inorg.chem.msu.ru/ )

• Petr S. Berdonosov
• Inorganic Chemistry Division

... General Psychology . Psychophysiology . ... Social Psychology . ... Psychological Principles of Personality Correction . ... Historical Psychology of Personality . ... Psychophysiology of Functional States . ... Social Psychophysiology . ... Psychological Influences on a Person in Clinical Psychology . ... Non-Russian Social Psychology in 20 th Century . ... Social Psychology of Personality . ... Process of Investigation in Social Psychology . ... Qualitative Analysis in Social Psychology . ...

Еще в разделе: (Показать все результаты (>202) - www.psy.msu.ru/ )

... к/а]Senior Business Analyst (SAP APO) . ... We are currently looking for Senior Business Analyst to work in Moscow, Russia for our client - one of the biggest international FMCG companies. ... Implementation project expertise in SAP and APO. ... Re: [к/а]Senior Business Analyst (SAP APO) [ re: apafelak ] . ... Re: [к/а]Senior Business Analyst (SAP APO) [ re: Kolya ] . ... Re: [к/а]Senior Business Analyst (SAP APO) [ re: Vanger ] . ... Re: [к/а]Senior Business Analyst (SAP APO) [ re: Manager ] . ...

Еще в разделе: (Показать все результаты (>4185) - www.snto-msu.net/ )

• Детализация рейтинга: Elion - Public forum of MSU united student networks
• [linux] stardict and utf8 problem - Public forum of MSU united student networks
• [Problem] Про новый КВН - Public forum of MSU united student networks

... Главная -> Фильмы -> A Problem with Fear . ... Фильмы . ... A Problem with Fear . Канада 2003 . ... Marnie Alton . ... Gregory D. Alvas . ... Anita Matthys . ... Brian Stollery . ... Leigh Ann Taylor . Brian Wrench . ...

Еще в разделе: (Показать все результаты (>282) - kinfo.ru/ )

• Problem Child - Фильмы - Kinfo.ru
• The Dog Problem - Фильмы - Kinfo.ru
• Problem Child 2 - Фильмы - Kinfo.ru

Date: Mon, 1 Jul 1996 16:03:06 -0700 (PDT) From: Alexei Kosut <akosut@organic.com> To: Apache Group Subject: Re: keepalive and windoze Good news and good news (of a sort).. I was able to snag a Windows 95 machine here at Organic, and tried out some things: 1) On Netscape 3.0b4, I was able to reproduce the bug, each and every time. ... Alexei Kosut <akosut@organic.com> The Apache HTTP Server http://www.nueva.pvt.k12.ca.us/~akosut/ http://www.apache.org/ . ...

Еще в разделе: (Показать все результаты (>75) - neptun.sai.msu.ru/ )

• Test Page for Apache Installation
• Issues Regarding DNS and Apache
• Custom error responses

... 12, 43 ­ 44 (2012) / DOI 10.1002/pamm.201210013 Cases of Complete Integrability in Transcendental Functions in Dynamics and Certain Invariant Indices Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., 1, 119899 Moscow, Russian Federation The results of this work appeared in the process of studying a certain problem on the rigid body motion in a medium with resistance, where we needed to deal with first integrals having nonstandard properties. ...

Еще в разделе: (Показать все результаты (>44) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-134-1.pdf
• http://shamolin2.imec.msu.ru/art-133-1.pdf
• http://shamolin2.imec.msu.ru/art-98-1.pdf

. To see a Russian version of this page, click here . (Professor, Director of SAI. Graduated from the Moscow State University (MSU) in 1964, Ph.D. 1967, MSU, Dr. of Science 1975, MSU) . A member of IAU and EAS, IAU committees No 42, 27. Fields of interest: Stellar astrophysics, close binary systems, inverse problems in astrophysics. Send your mail to: cher@sai.msu.su .

Еще в разделе: (Показать все результаты (>24) - uranus.sai.msu.ru/ )

• Tatjana Khruzina
• Igor Antokhin
• The Database of Close Binary Systems

VIDEO SUPER-RESOLUTION WITH FAST DECONVOLUTION * A. Krylov1, A. Nasonov1, O. Ushmaev 2 1 Laboratory of Mathematical Methods of Image Processing, Faculty of Computational Mathematics and Cybernetics, Lomonosov Moscow State University, 119991, Russia, Moscow, Leninskie ... Informatics Problems of the Russian Academy of Sciences, 119333, Russia, Moscow, Vavilova, 44, 2, (499) 135-62-60, olegu@biolink.ru Super-resolution problem is posed as an inverse ... It depends on given images. ...

Еще в разделе: (Показать все результаты (>196) - imaging.cmc.msu.ru/ )

• Research | Laboratory of Mathematical Methods of Image Processing
• Image processing | Laboratory of Mathematical Methods of Image Processing
• Image resampling and superresolution | Laboratory of Mathematical Methods of

... P hysics Faculty, Moscow State University, . ... Moscow State University, Physics Faculty, Diploma work in Hydrodynamics . ... Title: «Dynamical Stochasticity of Nonlinear Systems and a Prediction Problem» . ... The First International School-Conference BILLIARDS’09 – « Mathematics and Physics of Billiard-Like Systems », February 16-19, 2009, guas de Lindoia, SP, Brazil . ... Invited Lectures «Chaos in Dynamical Systems», The Space Research Institute, Russian Academy of Science, Moscow, Russia . ...

Еще в разделе: (Показать все результаты (>81) - chaos.phys.msu.ru/ )

• Alexey Ryabov

... Lectures, Questions & Answers . ... Evgeny V. Antipov (Faculty of Chemistry, Moscow State University) New cathode materials for lithium batteries . Questions and Answers . ... Questions . Vladimir I. Feldman (Faculty of Chemistry, Moscow State University) Physics and chemistry of solvated electron . ... Galina A. Tsirlina (Faculty of Chemistry, Moscow State University) Diversity of electrochemistry: the specific problems of molecular models and their experimental verification . ...

Еще в разделе: (Показать все результаты (>25) - www.elch.chem.msu.ru/ )

• Laboratory of Electrical Double Layer and Electrode Kinetics
• Laboratory of Electrochemical energetics

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• About

... hall in front of room 01, MSU, Main Building . ... room 01, MSU, Main Building . ... Silvia Chelala (Empire State College, State University of New York, Old Westbury, New York, USA) Designing and Teaching Introductory Spanish as a Foreign Language at a Distance . ... FFL, recreation hall, 3rd floor . ... FFL, room 519 . ... FFL, room 501 . ... FFL, . room 107-108 . ... Internet-Supported Teaching . ... FFL, room 106 . ... FFL, room 416 . ... FFL, room 420 . ... FFL, room 210 . ...

Еще в разделе: (Показать все результаты (>19) - anazarenko.ffl.msu.ru/ )

• Факультет иностранных языков и регионоведения МГУ. Центр дистанционного

... Институт русского языка и культуры - учебное подразделение љ МГУ имени М.В.Ломоносова , которое занимается преподаванием русского языка как иностранного и неродного,љподготовкой иностранных граждан к обучению на профильных факультетах МГУ и в других высших учебных заведениях России, повышением квалификации и переподготовкой специалистов по профилю РКИ, тестированием, а также распространением и продвижением русского языка во всем мире. ... Институт русского языка и культуры МГУ имени М. В. Ломоносова...

156. http://cytol.bio.msu.ru/docs/Information%20letter%202014-1.doc

157. Curriculum Vitae of Prof. Alexander P. Seyranian

158. http://acoustics.phys.msu.ru/blank.htm