... News . ... TLE news . ... Publications on Transient luminous events . ... The UHECRs will be detected through the measurement of the emission in the range between 290 and 430 nm, where some part of Transient Luminous Events (TLEs) emission also appears. ... Luminous event parameters (atmosphere altitude, energy released to radiation, and temporal pro?les) are similar to observed elsewhere parameters of transient luminous events (TLE) of elves, sprites, halo, and gigantic blue jets types. ...
... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...
LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ HYDROACOUSTIC ANTENNA : A POWERFUL TOOL TO FORECAST TSUNAMIGENIC EARTHQUAKES Yakov S. Karlik Central Research Institute MORPHYSPRIBOR , 46 Chkalovsky proezd, Sankt-Petersburg, 197378 Russia E-mail: karlik@mail.cl.spb.ru ABSTRACT Hydroacoustic antenna ... 2001). ... Eiby, J.A., 1982: Earthquakes. ...
... 12, 43 44 (2012) / DOI 10.1002/pamm.201210013 Cases of Complete Integrability in Transcendental Functions in Dynamics and Certain Invariant Indices Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., 1, 119899 Moscow, Russian Federation The results of this work appeared in the process of studying a certain problem on the rigid body motion in a medium with resistance, where we needed to deal with first integrals having nonstandard properties. ...
... Полная версия: Технические работы на сервере . Грация-МГУ::Форум > Общение > Другая жизнь . ... Apr 14 2011, 00:01 . ... сегодня весь день на сервере будут проводиться технические работы. ... Subject: Internet cleaning.....very important.. ... hours in order to allow us to clean it. ... Internet. ... Internet users has grown dramatically. ... to other sysops and Internet users as well. ... Internet users has grown dramatically. вопщем, очистка интырнетов это прекрастно во всех отношениях, ящитаю . ...
... All Authors Title Abstract Index terms Full Text . ... Home > ICONO/LAT 2016 > 2014 International Conference on Laser Applications in Life Sciences > About the Conference > Submissions . ... All URL addresses in the text (e.g., http://pkp.sfu.ca ) are activated and ready to click. ... If submitting to a peer-reviewed track of the conference, authors' names are removed from submission, with "Author" and year used in the bibliography and footnotes, instead of authors' name, paper title, etc. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Some aspects of engineering solutions of ozonizer and ozone sensor. .. , . ... 30000 . ... Air cooling for ozonizer is always simpler and cheaper than water cooling. ... On the other hand it demands good adhesion between dielectric enamel and aluminium radiator. ... Discharge from needle allows generate ozone from non prepared air, but its efficiency is small. ... It is very reasonably to install little compressor in ozone sensor, which allows to inhale air probes from any narrow places. ...
[
Текст
]
Ссылки http://www.kge.msu.ru/ozone/archives/1rus_conf_pr/Presentations/Vorokhobov.pdf -- 273.5 Кб -- 29.08.2005 Похожие документы
... Ярмарка вакансий и стажировок для студентов и выпускников вузов . Новости науки и техники События . ... Вакансии . ... Ярмарки вакансий и выставки . Информация о компании: PwC . ... Manage users' accounts on the Definity telephony switch . ... Definity switch as well as on the telephony cross Требования: . ... Все предложения от компании PwC . ... Если вы хотите регулярно получать информацию о новых вакансиях, наших мероприятиях и новостях сайта, оставьте, пожалуйста, свой адрес. ...
... Кафедры . ... Практика . Производственная практика 2015 . ... IS PLEASED TO WELCOME INTERNATIONAL STUDENTS TO . ... International students enjoy both a regular curriculum and an in-depth study of the Russian Language, Russian Culture and History of Russia. ... a certified Russian translation ofљ both the original of Secondary School Certificate (or equivalent) and its attachment. ... a certified copy of ID/passport (the original of ID/passport is to be produced on application) . ...
Marketing Plan Outline Canada Business Service Centres - CBSCs Last Verified: 2004-11-08 Document No. 4014 Summary A marketing plan is designed to direct company activities towards the satisfaction of customer needs; determine what the customer wants, develop a product/service to meet those needs, get the product/service to the end user and communicate with the customer - at a profit! ... levels, sales volumes? ... What is the consumer acceptance price range for this type of product/service? ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/english/marketingplanoutline.doc -- 131.0 Кб -- 27.10.2005
[
Текст
]
Ссылки http://innovation.msu.ru/english/marketingplanoutline.doc -- 131.0 Кб -- 27.10.2005 Похожие документы
THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Nanocrystalline materials based on metal oxides for the detection of toxic and hazardous gases in the air. ... sensorovEst material group hopes that the new materials developed at the Faculty of Chemical laboratory "Chemistry and physics of semiconductor and sensor materials " will substantially increase the artificial olfaction. ... Acetone Sensing by Modified SnO 2 Nanocrystalline Sensor Materials. ...
... On-line консультант . ... Приглашаем всех, интересующихся исследованиями и разработками в области компьютерных сетей, принять участие в семинаре по software-defined networking, который состоится 4 июля 2011 (понедельник) в 19.30 в Политехническом музее (Новая площадь, д 34;, подъезд 9, малая аудитория). ... We are about to witness a revolution in the networking towards so-called "Software Defined Networking" (SDN). SDN enables innovation in all kinds of networks . ... Copyright ВМиК МГУ , 2008 . ...
... About Us . ... The Department of Spanish Language . ... According to the information stated above, Spanish language department students are trained in the following areas: . ... Also, the Department of Spanish Language is the only department where detailed studying of Spanish language peculiarities and linguistic ethnical consciousness in Spain and Latin America are provided, thanks to specialized courses and seminars, apart from language studying, at a student's choice during 8 semesters. ...
... Web portal on atmospheric environment is developed by international consortium as a be-lingual information resource in area of atmospheric physics and chemistry and in related domain air quality assessment and management. ... The portal has all typical component and services like collections of links, user group registration, discussion forum, etc. ... Each scientific site is an information-computational system designed in Internet technologies. ... 00189 138. ... 2003 . ... 2002, 252 . ...
... In particular, Jmol.js uses the split version. ... To invoke JmolApplet.jar from Jmol.js, either: a) put it in the folder containing the HTML page requiring it and do not use jmolInitialize() or b) identify it explicitly in jmolInitialize(), for example: jmolInitialize("folder-containing-jar-files", "JmolApplet.jar") - JmolAppletSigned.jar An equivalent version of the applet, but this is a "signed" or "trusted" applet (a term in Java security language). ...
... Faculty of Physics . ... 7 (495) 939-16-82 info@physics.msu.ru . ... Contacts . ... Education . ... Noise studies helps to improve the fiber-optical communication distance . ... Researchers from Prof. S.P.Kulik s group at the Department of Physics, MSU have developed the experimental method for detector tomography of optical spatial mode detectors. ... One of the ways to overcome the limitations is to use high-dimensional spatial mode encoding and/or multiplexing. ... Faculty of Physics, 2016 . ...
International School "Frontiers in Numerical Gravitational Astrophysics" . Erice ( Italy ), june 27-july 5, 2008 . ... you and/or your students may be interested in the Course "Frontiers in . Numerical Gravitational Astrophysics" that will be held in Erice (Italy) . ... Univ. of Roma, La Sapienza , Italy . ... Univ. of Texas, Austin, USA . ... FRONTIERS IN NUMERICAL GRAVITATIONAL ASTROPHYSICS| . 2nd Course of the International School on | ... Joshua Barnes (Univ. of Hawaii, USA) . ...
1, 120101 (2012) : . 119991, , , . ... Alternative core environmental mo dule for students : features of the foundations of ecology from the physics p ositions V. A. Gordienko 1 1,a , K. V. Pokazeev 2,b , M. V. Starkova 3,c 3 M. V. Lomonosov Moscow State University, Physical Faculty, Department of Acoustics. ... Keywords : ecology and environmental management, environmental education, a systematic approach to the ecology and current environmental problems, modeling and prediction in ecology. ...
... More Reports . ... Variety of long-eared owls (Asio otus) diet, as index of habitat usefulness // Mobility of students and programmes flexibility in the prospect of the European unification of the training processes in ecology and environmental science. ... Long-eared owl A.otus rather actively masters anthropogenous landscapes. In this connection it is interesting to observe change of various aspects of ecology of this species, in particular, dynamics of its food objects. ...