. GROUP JUNE 20 10 . From left to right : Sofia Suslova, Baia Egorova, Dr. Elena I. Ardashnikova, Dr. Peter S. Berdonosov, Prof. Valery A. Dolgikh, Dr. Dmitri O. Charkin, Nikolay Saushkin and Arman Sadybekov . + 4 members offline . Silich Konstantin . Back

Еще в разделе: (Показать все результаты (>41) - www.inorg.chem.msu.ru/ )

... The earlier meaning assigned to ca- was `to set up, dedicate', while C. Melchert believes that verbs formed from this root can mean both `to promise, pledge' and `to agree, assent'.7 The verbal root o- also seems to refer to some sort of verbal activity.8 The root of the cognate stems i- and in- is probably the same as that of Hitt . ie- and Luw. - `to do, make', and the meaning of the Hittite and Luwian verbs suits the appropriate Lydian contexts.9 ... 7 Melchert 1997: 39-41. ... EWL ~ Lyd...

Еще в разделе: (Показать все результаты (>20) - imk.msu.ru/ )

• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/palaic1.pdf
• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/refl-ucla.pdf

Doxyfile 1.4.6-NO # This file describes the settings to be used by the documentation system # doxygen (www.doxygen.org) for a project # # All text after a hash (#) is considered a comment and will be ignored # The format is: # TAG = value [value, .. ... USE_WINDOWS_ENCODING = YES # If the BRIEF_MEMBER_DESC tag is set to YES (the default) Doxygen will # include brief member descriptions after the members that are listed in # the file and class documentation (similar to JavaDoc). ... The default is NO. ...

Еще в разделе: (Показать все результаты (>10) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2013.PRIA.Mamaev_Lukin_Yurin.HermiteNLM.en.pdf

ISSN 0026-2617, Microbiology, 2008, Vol. ... Key words: late stationary phase, secondary growth, Pseudomonas aeruginosa, S and M dissociants, population structure of the culture. ... Growth dynamics and population composition of a mixed culture of P. aeruginosa S and M dissociants in the variant of autolysis in the late stationary phase: optical density, OD з 100 (1); ratio of the M dissociant in the population, % (2); pH (3); and content of reducing sugars, mg % (as glucose) (4). ...

Еще в разделе: (Показать все результаты (>12) - dis.bio.msu.ru/ )

The paper of Eugene Babaev "Intuitive Chemical Topology Concepts" . ... These objects with quite different geometrical properties have homeomorphic 2 D surfaces, which can be continuously deformed one to another or to the same surface of a torus. ... This approach (a generalization of our earlier works [29-33]) allows us to apply the homeomorphism concept to chemical problems in a new way, classifying molecular structures and reactions from the viewpoint of the topology of surfaces. ... Surfaces . ...

Еще в разделе: (Показать все результаты (>124) - www.chem.msu.ru/ )

• Concept of Chemical Periodicity: from Mendeleev Table
• Семинар "Перспективные наноматериалы"

... НАШ ФАКУЛЬТЕТ . ... Учебный отдел . ... Комплексное социологическое исследование: ?Современная система высшего образования глазами студентов, аспирантов и профессорско-преподавательского состава МГУ имени М.В. Ломоносова? ... Представляем Вашему вниманию программу 24-й секции ?Социальные исследования и современность?, которую проводит Высшая школа современных социальных наук МГУ имени М.В. Ломоносова. ... Copyright 2016 Высшая школа современных социальных наук (факультет) МГУ имени М.В.Ломоносова. ...

Еще в разделе: (Показать все результаты (>18) - vshssn.msu.ru/ )

... In the geometry of measurements to be specified below , where the anisotropy is most strongly pronounced, the coincidence angular distribution in a far zone will be shown to be much narrower than both the same distribution in the orthogonal geometry and the pump. ... FIG. ... Figure 8 shows two sets of experimental angular distributions solid line received in a single-particle and b coincidences measurements, which are plotted together for dif- ferent geometries, with a slit broadened pump beam. ...

Еще в разделе: (Показать все результаты (>113) - qi.phys.msu.ru/ )

• http://qi.phys.msu.ru/papers/2011-njp-13-083004.pdf
• http://qi.phys.msu.ru/kulik/Papers/e011802.pdf
• http://qi.phys.msu.ru/papers/2009-epl-87-64003.pdf

opportunities right in Goldman Sachs European Special Situations Group (ESSG), Moscow Sometimes the greatest are front of you. Internship, 6 months, Immediate Start Goldman Sachs is a global investment banking, securities and investment management firm. ... ESSG is the European arm of Goldman Sachs Global Special Situations Group with over $20bn assets under management. ... Closing date: 26 October 2007 Goldman Sachs is an equal opportunity employer. ...

Еще в разделе: (Показать все результаты (>37) - www.msu.ru/ )

• http://www.msu.ru/science/details/2010/101021-moscow-eu-ru-call.pdf

Nuclear Instruments and Methods in Physics Research B 206 (2003) 830­837 www.elsevier.com/locate/nimb Gas cluster ion beam applications and equipment Allen Kirkpatrick * Epion Corporation, 37 Manning Road, Billerica, MA 01821, USA Abstract Interactions of gas cluster ions with solid surfaces, and prospective applications for those interactions, have been research topics of interest for several years. ... Cluster ion surface interactions Fig. 3 shows a simple representation of cluster impact. ... Fig. ...

Еще в разделе: (Показать все результаты (>96) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/Articles_GSIB/nimb237_235_reviewGCIB_SConductors.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb206_846_craterformation_Clasterion_Yamada.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb206_902_Yamada_largeClasterIonCurrent.pdf

... Главная . Новости . ... Каталог с/х ресурсов . ... Forums . Helps and Supports . ... Каталог предприятий . Каталог товаров . ... Обратная связь . ... Получайте последние обновления, новости и многое другое.. ... Helps and Supports Back to Top . ...

Еще в разделе: (Показать все результаты (>4) - www.agrorus.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/phylogeny/Species_set1.doc
• http://mouse.genebee.msu.ru/phylogeny/Species_set2.doc
• http://mouse.genebee.msu.ru/phylogeny/Species_set3.doc

... Таня Трубичева, Коля Чеботарев, Сергей Меженный, Андрей Лебедев . ... Слева направо: Паша Зинюков, Булат Мавлюдов, Галя Ивутина (выше), Муся Григорян, Саша Игнатьев. ... Слева направо: 1)Аня Ноздрачева, 2)Дима Китаев, 3)Миша Ноздрачев, 4)Женя Цибиков, 5)Костя Фирсов, 6)Володя Трифонов, 7)Тамара Голубицкая, 8)Таня Михайлина, 9)Саша Игнатьев, 10)Валя Рябинкина, 11)Таня Чеботарева, 12)Оля Гусева, 13)Коля Чеботарев. ... Таня Гужва, Таня Немченко, Даниэль Усиков перед спуском в снежную . ...

Еще в разделе: (Показать все результаты (>11) - optics.sinp.msu.ru/ )

• polist99
• zagedan

... Data . ... Solar energetic particles . ... Solar flare database (RU) . ... Select the storm date: . Select storm intensity threshold: . ... Developed in 2007. Copyright €й 2007 - 2016 Skobeltsyn Institute of Nuclear Physics Moscow State University Feedback ...

Еще в разделе: (Показать все результаты (>26) - smdc.sinp.msu.ru/ )

... The characteristics of the materials we have selected, the procedure of winding the optic fibers and the coating process are described in detail. ... The `passive' inner cylinder, shown in the left part of the picture, was machined from an anticorodal aluminum rod while the conical part is used to lead the optic fibers from the coils down to the axis of the hydrophone. ... 6: The sensor after the coating process: the hydrophone (right) and the box --7-- containing the two fiber Bragg gratings. ...

Еще в разделе: (Показать все результаты (>12) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/INFN%20-%20NEMO.pdf
• http://antares.sinp.msu.ru/docs/INFN%20-%20ANTARES.pdf

... Publications . ... 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 . ... Borisov A. V. , Fedorov Y. N. , Mamaev I. S. Chaplygin ball over a fixed sphere: an explicit integration . ... The system generalizes the classical nonholonomic Chaplygin sphere problem and it is shown to be integrable for one special ratio of radii of the spheres. ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>142) - ics.org.ru/ )

... Enzymatic determination of ascorbic acid is based on its action as a second substrate of horseradish (HRP) and peanut (PNP) peroxidases in the reactions of o-dianisidine (OD) and 3,3',5,5'-tetramethylbenzidine (TMB) oxidation with hydrogen peroxide. ... Dependence of the duration of the induction period in the reaction of TMB oxidation catalyzed by HRP on the concentrations of the enzyme (1), H2 O2 (2), TMB (3) in the presence of 7 M ascorbic acid (0.1 M phthalate buffer solution, pH 4.5). ...

Еще в разделе: (Показать все результаты (>18) - analyt.chem.msu.ru/ )

• http://analyt.chem.msu.ru/kinetics/papers/Using%20enzymes%20isolated%20from%20diverse%20Mugin%20An%20Bioanal%202004-5.pdf

... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Extremal problems . ... Methods of finite differences in mathematical physics . ... 13 th Annual workshop will be organized by the of Department of Mathematics of Physics Faculty at Moscow State University , Moscow, Russia. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>2) - math.phys.msu.ru/ )

Pro jection Method for the Hankel Transform Andrey S. Krylov Maxim M. Mizotin 11 2011 . Numerical pro jection method for the zero-order Hankel transform inversion for the case of the data given on a finite interval has been developed. ... First, the inversion of the Hankel transform on a finite interval is an ill-posed problem. ... 5 The Sine-Fourier transform The pro jection method for the inversion of the sine-Fourier transform (5) with the data given on a finite interval was developed in [11]. ...

Еще в разделе: (Показать все результаты (>75) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2012.CISP-BMEI.Nasonov_Krylov.TextSR.en.pdf
• http://imaging.cs.msu.ru/pub/BandwidthExtension09.pdf
• http://imaging.cs.msu.ru/pub/2011.Graphicon.Lebedev_Ignatenko.Light.en.pdf

... Payment is made at transfer of means for the University account All expenses of transferring the money to the University account are beard by the Student. In the event the Student is expelled by the University for the lack of academic progress; transgression of the sections stated in Article 3; for the Student's own personal reasons; for medical reasons confirmed by the official medical paper, all payments made are non-refundable. Article 2 Obligation and rights of the University 2.1. ...

Еще в разделе: (Показать все результаты (>21) - foroff.phys.msu.ru/ )

• http://foroff.phys.msu.ru/illposed/programs/all_figures.txt
• http://foroff.phys.msu.ru/illposed/programs/Fig4_11.txt
• http://foroff.phys.msu.ru/illposed/programs/Fig4_2.txt

MSU Scientific Library Physics Faculty Library . UDK: universal decimal classification . ... Bible at Gateway.com (available different languages) Bible Bible-center . The list of literature links . ... William Burroughs see also William Burroughs . Library Network . Kharuki Murakami Kharuki Murakami. ... Different funny stories . Perseus Project (Perseus is an evolving digital library, engineering interactions through time, space, and language.) ... The Public's Library . ...

Еще в разделе: (Показать все результаты (>6) - astrometric.sai.msu.ru/ )