... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . ... dedicated to the outstanding Russian scientists . ... Moscow, April 10-14, 2007 Welcome . ... Dorodnicyn Computing Center of RAS, Computational Mathematics and Cybernetics Faculty of the M.V.Lomonosov Moscow State University and Russian Scientific Operations Research Society will organize the Vth Conference in April 2007 in Moscow. ...
... Results of experimental and numerical investigations of a permeable round parachute with the stripe-stabilizer, the so called "SAL" parachute - Stabilization of Aerodynamic Loads, are given [1]. ... The parachute canopy attained different shapes from each other depending on the value of reefing ( Fig.1 ). ... As given below some numerical investigations of the stripe-stabilizer reefing influence on the canopy shape, its aerodynamic drag and the tension of radial ribbons are considered. ...
Economic, industry and corporate trends A report from the Economist Intelligence Unit sponsored by Cisco Systems Foresight 2020 Economic, industry and corporate trends Contents Preface Executive summary Chapter 1: The world economy Chapter 2: Industries Automotive Consumer goods and retailing Energy Financial services Healthcare and pharmaceuticals Manufacturing Public sector Telecoms Chapter 3: The company Appendix I: Survey results 2 3 6 22 24 30 36 43 50 57 62 67 74 86 Appendix II: Methodology for
[
Текст
]
Ссылки http://bc.fdo.msu.ru/Nik_s/WorkFiles/DOC_files/World_shares_foresight_2020.pdf -- 425.8 Кб -- 20.03.2012 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Muller cells are living optical fibers Ё in the vertebrate retina Kristian Franze*, Jens Grosche*, Serguei N. Skatchkov, Stefan Schinkinger§, Christian Foja¶, Detlev Schild , Ortrud Uckermann*, ... California, Berkeley, CA, and accepted by the Editorial Board March 27, 2007 (received for review December 15, 2006) Although biological cells are mostly transparent, they are phase objects that differ in shape and refractive index ... 20 8287 8292 BIOPHYSICS Fig. ... Fig. ... Cell Isolation. ...
[
Текст
]
Ссылки http://cell.biophys.msu.ru/static/announce/media/files/Franze2007_Muller_cell_waveguide.pdf -- 1580.0 Кб -- 01.02.2014 Похожие документы
... 14, 1272-1280, 1993 4WLS REM F.Eisenhaber et al., ... 4WLS ASG ASN A 2 1 C Coil 360.00 174.13 100.5 4WLS ASG ILE A 3 2 H AlphaHelix -65.58 -34.58 21.6 4WLS ASG SER A 4 3 H AlphaHelix -67.41 -34.72 65.3 4WLS ASG ASP A 5 4 H AlphaHelix -69.55 -39.41 98.3 4WLS ASG VAL A 6 5 H AlphaHelix -59.80 -39.72 8.2 4WLS ASG ALA A 7 6 H AlphaHelix -63.69 -45.57 10.6 4WLS ASG LYS A 8 7 H AlphaHelix -59.04 -49.14 156.7 ...
Network Working Group R. Fielding Request for Comments: 2068 UC Irvine Category: Standards Track J. Gettys J. Mogul DEC H. Frystyk T. Berners-Lee MIT/LCS January 1997 Hypertext Transfer Protocol -- HTTP/1.1 Status of this Memo This document specifies an Internet standards track protocol for the Internet community, and requests discussion and suggestions for improvements. Please refer to the current edition of the "Internet Official Protocol Standards" (STD 1) for the standardization state and status of this
. Евгений Вареник, 28 февраля 2006 . Схема Горнера вычисления значения полинома в точке. Доказательство ее оптимальности в худшем случае по числу операций "сложение" и "умножение" среди алгоритмов, использующих только эти операции. Материалы к докладу: . E.M. Reingold and A.I. Stokes, Simple proofs of lower bounds for polynomial evaluation, in: R.E. Miller and J.W. Thatcher, Eds., Complexity of Computer Computations (Plenum, New York, 1972) 21--29.
dan.guru.ru . Главная :: Об авторе . dan@parallel.ru . Об авторе: . ... Никитенко Дмитрий Александрович . ... ф-т вычислительной математики и кибернетики МГУ имени М.В. Ломоносова . 2002 . ... Научно-исследовательский вычислительный центр Московского государственного университета имени М.В.Ломоносова . ... 7(495)939-5216, +7(495)939-2347 . ... http://dan.guru.ru . Москва, 2002-.. ...
... On-line консультант . ... Место работы, должность: Преподаватель, старший научный сотрудник Лаборатории Вычислительных комплексов ВМК МГУ имени М.В.Ломоносова . ... D. Gamayunov, R. Smeliansky. ... 2002. (in Russian) . D. Gamayunov, A. Kachalin. ... In proceedings of the fifth Russian Applied and . ... detectors of computer attacks for corporate networks. ... I. Bulgakov, D. Gamayunov, E. Toroschin, Detecting network worms . ... Опыт работы по тематике магистратуры: 9 лет (руководство . ...
Lomonosov project . News . ... Scientific goals . ... Scientific equipment . ... June 8, 2011 . ... Space platform, scientific equipment, ground control center (GCC), the variants of launching rocket were discussed. ... Discussed issues related to the supply flight models of scientific equipment blocks to VNIIEM. ... Thermal-vacuum tests of the tap node of electrical photomultiplier block ofљ TUS device were started. ... Thermal-vacuum tests of the technical model of BDRG device were started. ...
WRF . ... NCEP/NCAR, . ... WRF (Weather Research and Forecasting Model), , ' -35' (-35) ' -36' (-36). ... 11.12.2007 . ... 100 % . ... 400 . ... Fels S.B., Schwarzkopf M.D. The simplified exchange approximation: a new method for radiative transfer calculations // Journal of the Atmospheric sciences. ... Vol. ... Janjic Z.I. The surface layer in the NCEP Eta model. ... Janjic Z.I. Nonsingular Implementation of the Mellor-Yamada Level 2.5 Scheme in the NCEP Meso model // NCEP Office Note. ...
[
Текст
]
Ссылки http://atm563.phys.msu.ru/rus/gidromet_public_html/trudy/thmc3440111.pdf -- 1474.5 Кб -- 14.03.2011 Похожие документы
... For the case of the circular trajectory, two families of exact solutions are obtained. ... These exact solutions allow us to obtain approximate solutions for the case of an elliptic trajectory of the waist. ... We also check the condition of keeping contact with the waist during twirling. ... Main relations We assume that the center O of a gymnast's waist moves in time according to the elliptic law x = a sin t, y = b cos t with the amplitudes a, b and the excitation frequency > 0, Fig. ...
[
Текст
]
Ссылки http://belyakov.imec.msu.ru/papers/Belyakov_Seyranian_6pages2011.pdf -- 2709.9 Кб -- 30.07.2011 Похожие документы
... Вернуться к предыдущей задаче . ... Задача ?13 . ОПРЕДЕЛЕНИЕ ФИЗИЧЕСКИХ ПАРАМЕТРОВ ГАЗА В ЯДРЕ . СЕЙФЕРТОВСКОЙ ГАЛАКТИКИ . ... Ядро характеризуется необычайно широкими эмиссионными линиями, свидетельствующими о движении газа со скоростями в тысячи км/с. В настоящей задаче исследуется спектрограмма ядра сейфертовской галактики, и по относительным интенсивностям спектральных линий определяются физические параметры излучающего газа. ... Определить параметры газа в ядре сейфертовской галактики. ...
... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...
[
Текст
]
Ссылки http://np-chair.sinp.msu.ru/download/epja100510-offprints.pdf -- 426.2 Кб -- 18.03.2015 Похожие документы
... The data on UV glow of the atmosphere obtained in operation of one pixel of the TUS detector on board the Moscow State University "Universitetsky-Tatiana" satellite was taken into account in design of the updated TUS detector. ... The main feature of the design is use of MEMS technology scanning mirror controlled by the TUS computer, analyzing the recorded EAS data and directing the laser to the atmosphere spot, where back scattered Cherenkov light came from. ... Monitoring of UV intensity on-route....
[
Текст
]
Ссылки http://cosrad.sinp.msu.ru/experiments/tus/doc/HO2COSPAR2006.pdf -- 237.2 Кб -- 19.03.2008 Похожие документы
... MSU Chamber Orchestra . ... Chamber Orchestra of Moscow State University was born in 1967. ... It was originally formed as a chamber orchestra at the School of Mathematics and Mechanics but soon (since September 1967) transformed into a Chamber Orchestra of the Moscow State University. ... The Chamber Orchestra of Moscow State University won the first prizes in the 1-st and 2-nd All-Union festivals of non-professional arts. ... Moscow State University does not have its own School of Music. ...
... Porokhov, N., Kalabukhov, A., Chukharkin, M., Maresov, A., Khrykin, D., Klenov, N., and Snigirev, O. The physical basis of the fabrication of the third generation of high-temperature superconducting wires on quartz substrates.љ ... DOI љ] . ... Journal of Superconductivity and Novel Magnetism љ(2014). ... Сhukharkin, M., Kalaboukhov, A., Schnaiderman, J., Oisjoen, F., Jonsson, M., Xie, M., Snigirev, O., Winkler, D. Novel hts dc squid solutions for nmr applications. ... Superconducting electronics . ...
УЧЕБНОЕ ПОСОБИЕ ПО АНГЛИЙСКОМУ ЯЗЫКУ ДЛЯ СТУДЕНТОВ-ГЕОЛОГОВ 1 КУРСА ЧАСТЬ 1 Н.Г.КИТКОВА, Т.Ю.САФЬЯННИКОВА Рецензенты: Д.г.-м.н., профессор МГУ имени М.В.Ломоносова Н.В.Короновский К.ф.н., заведующая кафедрой иностранных языков РГГУ нефти и газа имени Губкина Е.Ю.Симакова Содержание Introductory Section A scientist Studies Science Section I. Meet the Sciences Unit I: What is Science? Unit II: Geology as a Science Unit III: Branches of Geology Unit IV: The Importance of being a Geologist Unit V: Revision
[
Текст
]
Ссылки http://www.geol.msu.ru/obsh/uch_ch1.doc -- 1082.0 Кб -- 08.04.2016
[
Текст
]
Ссылки http://geol.msu.ru/obsh/uch_ch1.doc -- 1082.0 Кб -- 08.04.2016 Похожие документы