... Preferences . ... Date & Time . ... Time zone: Default time zone Africa /Abidjan Africa /Accra Africa /Addis_Ababa Africa /Algiers Africa /Asmara Africa /Bamako Africa /Bangui Africa /Banjul Africa /Bissau Africa /Blantyre Africa /Brazzaville Africa /Bujumbura Africa /Cairo Africa /Casablanca Africa /Ceuta Africa /Conakry Africa /Dakar Africa /Dar_es_Salaam Africa /Djibouti Africa /Douala ... Note: Universal Co-ordinated Time (UTC) is also known as Greenwich Mean Time (GMT). ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... The laser system in which an optoelectronic negative feedback is realized by means of a signal reflected from an intracavity Pockels cell polarizer is proposed and tested. The design provides flexible control over pulse train time structure. ... Stable self -mode-locking occurs due to time delay in feedback control system corresponding to light pulse passage through the Pockels cell at the moment of low intracavity losses. ... The scheme of discontinuous control in the laser is shown in Fig. ...
ДД PROCEEDINGS OF THE 31st ICRC, LODZ 2009 1 Preliminary Proton and Helium Spectra from the CREAM-III Flight Y. S. Yoon , H. S. Ahn , T. Anderson, L. Barbier?, ... Keywords: CREAM; energy spectra; protons and helium nuclei I . ... CREAM-III I N S T RU M E N T A N D F LIGHT The CREAM-III instrument consisted of a tungsten/scintillating fiber calorimeter, a dual layer Silicon Charge Detector (SCD), a Cherenkov Camera (CherCam), a Cherenkov Detector, and a Timing Charge Detector (TCD). ...
... 1 The publication of this monumental work provides an appropriate occasion for reexamining the meaning of certain problematic Luwian lexemes and constructions. ... Hieroglyphic Luwian (HLuw.) remained the only written language in Anatolia for several centuries, until the conquest of Neo-Hittite states by Assyria and possibly the spread of alphabetic writing brought an end to the hieroglyphic scribal tradition. ... A very cautious approach is adopted with regard to translation. ... VAS")a-tara/i-i-na...
[
Текст
]
Ссылки http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/luwian.pdf -- 1120.0 Кб -- 30.04.2010
[
Текст
]
Ссылки http://imk.msu.ru/Structure/Linguistics/yakubovich/download/luwian.pdf -- 1120.0 Кб -- 30.04.2010 Похожие документы
... International Relations in Context of Global Processes - 17| ... GLOBAL ECONOMIC AND POLITICAL TRENDS Prof. Olga Y. Kornienko Economic literature survey Week 1 (4 academic hours ) 1) Current trends of global economy Week 2 (4 academic hours ) 2) Migration, population and globalization Week 3 (4 academic hours ) 3) Corporate culture and management: new trends Week 4 (4 academic hours ) 4) Development markets in global environment Week 5 (4 academic ... Models of the global world. ...
[
Текст
]
Ссылки http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf -- 1512.1 Кб -- 23.03.2016
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2014/06/Academic-Guide-for-FGS-MSU.pdf -- 1512.1 Кб -- 27.06.2014 Похожие документы
... H. Purcell: The Fairy Queen - Act II . Г. Перселл: Королева фей - Акт II . Act I . ... The fairies entertain their queen with songs dances until Titania asks them to sing her a lullaby: immediately four allegorical figures - Night, Mystery, Secresie and Sleep - approach to do her bidding. ... Феи развлекают свою королеву песнями и танцами, пока она не просит спеть ей колыбельную: тотчас же четыре аллегорические фигуры - Ночь, Тайна, Секрет и Сон - приближаются, чтобы выполнить ее приказания. ...
The monitoring of the optics quality of DIMM instrument V. Kornilov, B. Safonov May 24, 2010 1 Intro duction A quantitative theory of measurement of optical turbulence (OT) with Differential Image Motion Monitor (DIMM) is based on certain priori assumptions [1]. ... Bottom: behavior of the instrumental Strehl's number for the left (triangle to the left) and right (triangle to the right) DIMM images during the period of measurement the maintenance of an additional correction factor seems superfluous. ...
[
Текст
]
Ссылки http://curl.sai.msu.ru/mass/download/doc/shtrel_controls.pdf -- 159.0 Кб -- 24.05.2010 Похожие документы
... Главная :: Проекты . ... Проекты: . ... На сегодняшний день существуют инструменты, позволяющие лишь в некоторой степени оценить степень использования ресурсов вычислительных комплексов. ... Разрабатываемый программный комплекс призван ответить на ключевые вопросы в области эффективности, причем как для администраторов вычислительных систем, так и для пользователей. ... 50 самых мощных вычислительных систем СНГ . ... Информационно-аналитический центр . ... История Московского университеты" . ...
... Aerospace and environmental medicine Automation and Remote Control Optoelectronics, Instrumentation and Data Processing Acoustical Physics St Petersburg Mathematical Journal Algebra and Logic Angiologiia i sosudistaia khirurgiia = Angiology and vascular surgery Anesteziologiya i Reanimatologiya Antibiotiki ... Moscow University Mathematics Bulletin . ... Moscow University Chemistry Bulletin . ... Mathematics - , . ... Physics, Chemistry, Mathematics Nauchno-Tekhnicheskaya Informatsiya. ...
[
Текст
]
Ссылки http://www.geol.msu.ru/vestnik/spisok_vak.pdf -- 350.9 Кб -- 08.04.2016
[
Текст
]
Ссылки http://geol.msu.ru/vestnik/spisok_vak.pdf -- 350.9 Кб -- 08.04.2016 Похожие документы
MGU Botanic Garden . SCHEDULE OF EXCURSIONS FOR INDIVIDUAL VISITORS . If you want to express your opinion about our excursions or suggest any proposals and make remarks, write us at otzyv_botsad@mail.ru . ... The excursion bureau of the MSU Botanical Gardens invites in May-October schoolchildren, students and anyone wishing to admire the open air collections and listen to the captivating stories about plants. ... Plant taxonomy (for schoolchildren and university students) . ...
... СУНЦ МГУ . ... Краткая информация . ... Материалы экзаменов 1-го тура прошлых лет . ... Кафедры . ... Сотрудники . ... Кафедра химии . ... Сезонные школы СУНЦ МГУ . ... Олимпиадные сборы СУНЦ МГУ . Интернет-ресурсы СУНЦ МГУ . ... Заочная школа СУНЦ МГУ . ... Главная Подразделения Кафедры Кафедра химии Chemistry Chair . Chemistry chair of AESC MSU was founded at 13 November 1989 by professor of MSU Chemistry department Yu. ... Natalia Igorevna Morozova, docent, PhD (Chem.) ... Chemistry Chair . ...
... It is sometimes called the `thermoelectric figure-of-merit,' although this name is more often given to the dimensionless combination ZT sS 2 T X K In the above formulas, s, S, and K are respectively the material electrical conductivity, thermopower (Seebeck coefficient), and thermal conductivity, and T is the operating temperature or the average temperature T1 T2 a2 of the converter, with T1 and T2 being the respective cold and hot end temperatures. ... We first consider the thermal conductivity. ...
[
Текст
]
Ссылки http://lizard.phys.msu.su/home/science/Dmitriev-Zvyagin-10-Uspekhi-final.pdf -- 257.0 Кб -- 09.02.2011 Похожие документы
... The data on UV glow of the atmosphere obtained in operation of one pixel of the TUS detector on board the Moscow State University "Universitetsky-Tatiana" satellite was taken into account in design of the updated TUS detector. ... The main feature of the design is use of MEMS technology scanning mirror controlled by the TUS computer, analyzing the recorded EAS data and directing the laser to the atmosphere spot, where back scattered Cherenkov light came from. ... Monitoring of UV intensity on-route....
[
Текст
]
Ссылки http://cosrad.sinp.msu.ru/experiments/tus/doc/HO2COSPAR2006.pdf -- 237.2 Кб -- 19.03.2008 Похожие документы
Another mechanical model of parametrically excited pendulum and stabilization of its inverted equilibrium position Anton O. Belyakov 1 Lomonosov Moscow State University 2 Vienna University of Technology 8th European Nonlinear Dynamics Conference (ENOC 2014) Vienna, July 7, 2014 Scheme of a parametric pendulum y O l (t ) - g m 2 r1 + m 2 Equations of motion mr 2 1 d d2 + c1 + m g l (t ) sin () = 0 dt 2 dt (1) Dimensionless equation Three dimensionless parameters and ...
[
Текст
]
Ссылки http://belyakov.imec.msu.ru/papers/ENOC2014Presentation.pdf -- 707.6 Кб -- 26.09.2014 Похожие документы
... ОБЩИЕ СВЕДЕНИЯ О СЕТИ ИНТЕРНЕТ . ... Краткая история развития сети . История Интернет уходит своими корнями в ранний период развития компьютеров и компьютерных сетей. ... Осуществление таких жестких требований на практике стало возможным только путем использования уже существовавших компьютерных сетей. ... Но в сети Интернет возможно осуществить и более сложный режим пересылки информации с удаленного компьютера, получивший название протокола FTP (File Transfer Protocol). ...
... О Центре . ... Открытие Центра . ... Технологии Intel . Технологии программирования . ... Технологии Intel в основе учебного процесса . ... подробной технической информации о разработке игр, мультимедийных приложений, решений для совместной работы и финансового ПО; . ... Страница Центра компетенции (ЦК) СО РАН-Intel по высокопроизводительным вычислениям. Репортаж об официальном открытии Центра . ... Зарегистрируйтесь на сайте поддержки продуктов . ... на сайт поддержки. ...
... кафедра Исследования операций . ... Приветствие Традиционные темы конференции Основные даты Оформление тезисов Регистрация Программа конференции Размещение Программный коммитет Организационный коммитет Координаторы Контактная информация . ... 10-14 апреля 2007 Программа конференции . ... академик РАН А.А. Петров . ... А.В. Кузнецова, В.И.Лукьянов, О.А.Максакова, И.С.Меньшиков, О.Р. Меньшикова, О.В. Сенько . ... секция . ... МГУ, ВМК, ауд. ... 11 апреля 2007 . ... среда, 11 апреля 2007, ауд. ...
Lomonosov Moscow State University FACULTY OF ARTS 2011 ALEXANDER LOBODANOV DEAN OF THE FACULTY OF ARTS WxtЊ vҐЂЂxtzтxс4 g{x YtvтЂрч Ґy TЊрс уxЊx tvvx¶рxw |° ... Since 2003 he has been chairman of the Department of Semiotics and the General Theory of History, founded by him, the first of its kind in Europe. ... Department of Semiotics and the General Theory of Arts The Department of Semiotics and the General Theory of Arts is a theoretical department. ... Galina Zadneprovskaya manages this department. ...
... California State College at Los Angeles, 1966. -115p. Essays on Rhetorical Criticism. ... Cornell University Press. ... Cambridge ; New York : Cambridge University Press, 1979. x, 501 p. Boulton, James T. The criticism of rhetoric and the act of communication // Essays on Rhetorical Criticism. ... Burke Kenneth. ... The philosophy of literary form : studies in symbolic action / Kenneth Burke. 3d ed. Berkeley: University of California Press, [1974] c1973. xxvi, 463 p. Burke Kenneth. ...