... Oxford etc.: Oxford University Press, 2008. 432 p. (Oxford Early Christian Studies). ... III­ VI . ... 59­108). , , . ... 108­318). ... 20- III ., (. 400). (. 437): « (1689: iv, xxxviii) « ». ... 31 1899 .] ... 1911 [1913]. ... 1912 [1915]. ... 152­187; . ... 1915. ... 1911. ... Chron. ... 1- I (380 .) ... 187­189) , 95- 334­428 . ... 4 «» , 7 «The evidence is not compelling» (P. 189). ... 1- ; 1- I (380), (379): 380 . ... 189- , . 1- 250- ; 2- 187- ) . ...

Еще в разделе: (Показать все результаты (>101) - hist.msu.ru/ )

• "The New Emeralds Company" in the Urals (1899-1915)

. # . Home . Services . Interaction . Calculate Hydrogen bond, Water bridges and Hydrophobic interaction for . Home Browse Download Help About Us . List of complexes . Pfam families . SCOP families . Interaction classes . Interaction modes . GO terms . ERROR! File was not found. NPIDB team 2003 - 2016 . text .

Еще в разделе: (Показать все результаты (>5) - npidb.belozersky.msu.ru/ )

... Вычисление обратной функции нормального распределения вероятности. SF51R_c вычисляет значение x такое, что x 1/(2 ) 1/2 e - t*t / 2 dt = P , - где P - заданное значение вероятности (0 < P < 1). ... A.J.Strecok, On the Calculation of the Inverse of the Error Function, Mathematics of Computation, 22(101), 1968. real sf51r_c (real *p, integer *ierr) . ... ierr - . ... когда заданное значение вероятности p не принадлежит интервалу (0, 1); значение функции полагается равным 3.4e38. utsf12_c - . ...

Еще в разделе: (Показать все результаты (>39) - num-anal.srcc.msu.ru/ )

• БЧА НИВЦ МГУ. SF51R_P. Специальные функции математической статистики

... Point-split stress tensor and the Green's function. ... Casimir effect for a massless scalar field between two plates with the Dirichlet boundary conditions: one-particle states between the plates, explicit energy regularization and renormalization using the smooth cutoff. ... Casimir tension of a massless scalar field between two plates with the Dirichlet boundary conditions using the Green's function technique (the `pressure' Tnn version). ... Casimir energy renormalization. ...

Еще в разделе: (Показать все результаты (>5) - theorphys.phys.msu.ru/ )

• Kirill A. Kazakov
• Advanced Quantum Field Theory

Human longevity at the cost of reproductive success: evidence from global data ц б F . ... Abstract A trade-off between reproduction and somatic maintenance and hence survival is fundamental to life-history theory. We investigated the relationship between female fecundity and longevity in Homo sapiens using data from 153 countries located all over the world. The raw correlation between life span and fecundity was highly signi®cant with a negative trend. ... 1998; Polis et al., ...

Еще в разделе: (Показать все результаты (>31) - ecology.genebee.msu.ru/ )

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>8) - www.pereplet.ru/ )

Interpretation of Holocene Paleosols Derived from Volcanic Ash Fall Deposits in Japan . ... In many parts of Japan, we can observe profiles consisting of buried soils which have common features of a high content of humus and clay. ... The 10 m giant profile, located in Shizuoka Prefecture, Central Japan, consists of 6 Holocene buried soils, including Fuji Black Humic Ash (4.5-8.0 ka) after Machida(l968). ... The concentration of zirconium was higher in buried soils. ... Back to the Abstracts list ...

Еще в разделе: (Показать все результаты (>405) - www.fadr.msu.ru/ )

• INQUA/ISSS Paleopedology Commission Newsletter

... Institutes of Chernogolovka . The largest of all the scientific institutions of the center is the Institute of Chemical Physics in Chernogolovka , where fundamental problems of chemical physics are studied: kinetics and mechanisms of chemical and biological processes; processes of combustion, explosion, and polymerization; and mechanisms of elementary reactions involving high energy particles. ... Developments and Technologies . ...

Еще в разделе: (Показать все результаты (>12) - www.issp.ac.ru/ )

• II International Astronomy Olympiad, Problems to solve

... ATOMS, MOLECULES, OPTICS Modified Phase Matching Conditions for Second Harmonic Generation in a Finite One-Dimensional Photonic Crystal near the Bragg Condition: Weak and Strong Diffraction E. V. Petrov and B. I. Mantsyzov Moscow State University, Moscow, 119992 Russia e-mail: epetrov@genphys.phys.msu.ru; mants@genphys.phys.msu.ru Received December 20, 2004 Abstract--Enhanced noncollinear second harmonic generation in a finite one-dimensional ...

Еще в разделе: (Показать все результаты (>29) - genphys.phys.msu.su/ )

• http://genphys.phys.msu.su/rus/sci/photonics/PDF/9.pdf
• Публикации

In Silico Biology 3 (2003) 197­204 IOS Press 197 The Channel in Transporters is Formed by Residues That Are Rare in Transmembrane Helices Olga V. Kalinina1,*, Vsevolod J. Makeev1, Roman A. Sutormin1, Mikhail S. Gelfand1,2 and Aleksandra B. Rakhmaninova2 1 2 State Scientific Many genes encoding known or putative transport proteins are found in bacterial genomes. ... It is based on the analysis of amino acids frequencies in bacterial secondary transporters. ... Proteins 51, 85­95. ...

Еще в разделе: (Показать все результаты (>8) - storage.bioinf.fbb.msu.ru/ )

... Control of the Self Assembly Processes in a Droplet of a Colloidal Solution by an Acoustic Field O. V. Rudenkoa, P. V. Lebedev Stepanovb, V. A. Guseva, A. I. Korobova, B. A. Korshaka, N. I. Odinaa, M. Yu. ... The self assembly in the course of solvent evapora tion occurs owing to capillary forces, which displace the particles in the near surface layers of the solution as the volume of the latter decreases. ... For simplicity, we replace the actual droplet on a solid substrate by a plane liquid layer...

Еще в разделе: (Показать все результаты (>43) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/gusev_files/rao24-2.pdf
• http://acoustics.phys.msu.su/teachers/lecture/matmodel.pdf
• http://acoustics.phys.msu.su/teachers/rudenko_files/98sweisarv.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• StructAlign help

... J. 21(2): 197201 ї RUSSIAN ENTOMOLOGICAL JOURNAL, 2012 Single population dynamics: differences between classical and individual-based modeling approaches Динамика отдельной популяции: описание методами классического и индивидуально-ориентированного моделирования Janusz Uchmaсski Януш Ухманьски Institute of Ecology and Bioethics, Faculty of Christian Philosophy, Cardinal Stefan Wyszyсski University; e-mail: januch@cbe-pan.pl Wуycickiego 1/3, 01-938 Warsaw, Poland. ... What are the values of ri? ...

Еще в разделе: (Показать все результаты (>855) - zmmu.msu.ru/ )

• http://zmmu.msu.ru/rjt/articles/ther10_2%20071_081%20Abaturov.pdf
• http://zmmu.msu.ru/rjt/articles/ther11_1%20033_045%20Balakirev.pdf
• http://zmmu.msu.ru/rjt/articles/ther6_1%20027_033%20Illarionova.pdf

... The main interest of researchers was focused on TiO2:Co and TiO2:V thin films, that reveal an essential difference in their behavior: TiO2:Co films demonstrate either strong magnetization, MO response or AHE independently on presence or absence of magnetic Co clusters inside the films. ... It has been found that: thin films TiO2:Co(0.5%, 1.3% and 5%) have either magnetization or MO signal of Transversal Kerr effect with the absence of magnetic clusters. ...

Еще в разделе: (Показать все результаты (>22) - magn.phys.msu.ru/ )

• Information for PhD students
• Information about education on magnetism division

ISSN 0026-2617, Microbiology, 2008, Vol. ... Key words: late stationary phase, secondary growth, Pseudomonas aeruginosa, S and M dissociants, population structure of the culture. ... Growth dynamics and population composition of a mixed culture of P. aeruginosa S and M dissociants in the variant of autolysis in the late stationary phase: optical density, OD з 100 (1); ratio of the M dissociant in the population, % (2); pH (3); and content of reducing sugars, mg % (as glucose) (4). ...

Еще в разделе: (Показать все результаты (>4) - dis.bio.msu.ru/ )

• http://dis.bio.msu.ru/States/Fursova_Mil'ko_2006_en.pdf

... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty, room 581 (Head of the laboratory) . ... The Laboratory of Industrial Mathematics (LIM) headed by Professor V.M. Goloviznin was established in the Faculty of Computational Mathematics and Cybernetics (CMC) of Lomonosov Moscow State University in 2011. ... Running specialised computer modelling and simulation, high-qualification and certification courses targeted at the engineers of the leading Russian industry. ...

Еще в разделе: (Показать все результаты (>121) - en.cs.msu.ru/ )

• Laboratory of Industrial Mathematics
• Department of Systems Analysis | CMC MSU
• Department of Systems Analysis

Psychology in Russia: State of the Art · 2009 Quantitative estimation of the macropsychologic al state of modern russian society Andrey V. Yurevich, Dmitry V. Ushakov Institute of Psychology, Russian Academy of Sciences Moscow The authors give the quantitative estimation of the macropsychological state of modern Russian society based on its political, social and economic characteristics. For these purposes the composite index of the macropsychological state of society is developed. ...

Еще в разделе: (Показать все результаты (>153) - www.psy.msu.ru/ )

• Faculty of psychology Lomonosov Moscow State University