A project of laser electron X-ray generator for scientific applications I.A. Artyukov, E.G. Bessonov, A.V. Vinogradov, M.V. Gorbunkov, Yu.Ya. ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... It allows viewing collision of electrons with laser photons as the classical Thomson scattering. ... A project of X-ray laser-electron generator [7]. ...
... Hello everybody out there using minix - I'm doing a (free) operating system (just a hobby, won't be big and professional like gnu) for 386(486) AT clones. ... I'd like any feedback on things people like/dislike in minix, as my OS resembles it somewhat (same physical layout of the file-system (due to practical reasons) among other things). ... This implies that I'll get something practical within a few months, and I'd like to know what features most people would want. ...
... List of complexes . ... NPIDB, Nucleic acid ? Protein Interaction DataBase provides an access to structured and organized information about all available structures of DNA ? ... Since 2003, the database is available online. ... NPIDB: nucleic acid?protein interaction database . ... An updated version of NPIDB includes new classifications of DNA-protein complexes and their families . ... Sergey Vasilyev (the main developer of the first version of the database) . ... 03-04-48476 (2003 2005) . ...
... B Dispatch: 30.1.04 Author Received: Journal: JEB CE: Kumar No. of pages: 12 PE: Sri doi:10.1111/j.1420-9101.2004.00705.x Human birthweight evolution across contrasting environments F. T H OMAS , * A . ... The model illustrates that optimal birthweight depends on which fitness-reducing risk locally predominates (somatic diseases, parasitic diseases or adverse environmental conditions). ... Growth in utero, blood pressure in childhood and adult life, and mortality from cardiovascular disease. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf -- 284.1 Кб -- 16.03.2009 Похожие документы
... For the investigations of the phenomenon leading to non inflation (squidding) of parachute, the influence of canopy permeability and upstream flow on the character of pressure distribution along framework model, imitating round parachute, was studied experimentally. ... The pressure sensors: 13 ones inside and 13 - outside the canopy have been placed for the study of distribution of internal and external pressure on the surface of the model. ... Variant 1. ... Parachute Science] . ...
... Русский English . Background . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Each of FBB students is to successfully complete and defend three yearly research projects, in bioinformatics, biochemistry, and bioengineering. ...
... Sister cells with nonirradiated centrosomes and cells with partially irradiated cytoplasm were used as controls. ... Cells with irradiated centrosome survive in culture for a long time, but differ from sister and intact cells. ... The localization of B23 protein in cells with the irradiated centrosome sharply differed from that described above: in the nuclei of such cells the nucleoli were stained significantly weaker than in sister cells; besides, the karyoplasm was stained rather intensively (Fig....
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/neverova99.pdf -- 1643.8 Кб -- 28.05.2002 Похожие документы
... Veselovsky, V.A., Djanumov D.A. The use of biophysical methods in the study of adaptive reactions of plants, in connection with the problem of resistance. ... Kulaeva, O.N., Mikulovich T.P., Veselova, T.V., Veselovsky, V.A., Kukina, I.M., Klyueva N.Yu. ... Veselovsky, V.A., Veselova T.V . ... Nauka, Moscow (in Russian).1990. 200 p. Veselova T.V., Veselovsky V.A., Chernavsky D.S. Stress of Plant: A Biophysical Approach. ... Veselova T.V., Veselovsky V.A. Photosynthesis and stress of plant cells. ...
Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia email: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the socalled V Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY YMP supercomputers. al structure of the program. ...
... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...
Second announcement VII Moscow International Conference on Operations Research (ORM2013) Moscow, October 15-19, 2013 Dear colleagues, we invite you to attend the VII Moscow International Conference on Operations Research. ... Information on important dates, registration and abstract submission. ... An extended abstract should be presented as a LaTex file in English language according to the attached template, and its volume should be three pages (or little less). ...
[
Текст
]
Ссылки http://io.cs.msu.ru/ORM2013/ORM2013-2nd_ann-ENG.pdf -- 94.7 Кб -- 31.01.2013
[
Текст
]
Ссылки http://io.cs.msu.su/ORM2013/ORM2013-2nd_ann-ENG.pdf -- 94.7 Кб -- 31.01.2013
[
Текст
]
Ссылки http://io.cmc.msu.ru/ORM2013/ORM2013-2nd_ann-ENG.pdf -- 94.7 Кб -- 31.01.2013 Похожие документы
BIRD SPECIES DATABASE . of the Arctic Birds Breeding Conditions Survey . ... Queries . View list of species . ... Get list of species, for which data are available by pushing "Query" button below "View list of species" invitation. Latin name of a species can be copied from the list to the "Species name" field or typed-in there (but exactly as it appears in the species list). ... Query results will be tabulated in the window below the map, and can be browsed through or copied. ...
JOURNAL OF APPLIED PHYSICS VOLUME 96, NUMBER 1 1 JULY 2004 Theoretical analysis of the synergism in the dielectric strength for SF6 у CF4 mixtures A. V. Larin ґ Laboratoire de Physico-Chimie Informatique, Facultes Universitaires Notre-Dame de la Paix, Rue de Bruxelles 61, B ... Calculated electron energy distribution function EEDF for the SF6 /CF4 mixture solid lines and a pure CF4 dashed lines or b pure SF6 dotted lines vs the electron energy under the same E / N values as given in Table IV. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
The Shigeyoshi Matsumae Stadium in Moscow University was opened on September 1, 1989, on the campus of Moscow University, as the first full-scale stadium having artificial turf in the Soviet Union (at that time). ... The stadium was a gift by Tokai University to Moscow University, as the result of more than 20 years of exchange and friendship between Tokai University and Moscow University in exchanging students and teachers, as well as academic and cultural works since 1973. ...
ft ra D DAYS on DIFFRACTION 2012 1 Theory of selfrefraction effect of intensive fo cused acoustical b eams V.A. Gusev Lomonosov's Moscow State University, Physical Faculty, Department of Acoustics, Russia, 119991, Moscow, Leninskie gori; e-mail: vgusev@bk.ru The theory of selfrefraction of nonlinear acoustical beams is developed based on some exact and approximate analytical equations and solutions. ... What is the main factor limiting the pressure in the focus -- diffraction or selfrefraction? ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/gusev_files/diff2012.pdf -- 698.1 Кб -- 07.11.2012
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/gusev_files/diff2012.pdf -- 698.1 Кб -- 07.11.2012 Похожие документы
... О Центре . ... Открытие Центра . ... Технологии Intel . Технологии программирования . ... Технологии Intel в основе учебного процесса . ... подробной технической информации о разработке игр, мультимедийных приложений, решений для совместной работы и финансового ПО; . ... Страница Центра компетенции (ЦК) СО РАН-Intel по высокопроизводительным вычислениям. Репортаж об официальном открытии Центра . ... Зарегистрируйтесь на сайте поддержки продуктов . ... на сайт поддержки. ...
Козлов А.Н. Кинетика ионизации и рекомбинации в канале плазменного ускорителя. Известия РАН, механика жидкости и газа. 2000, ? ... Kozlov A.N. Modeling of rotating flows in the plasma accelerator channel with longitudinal magnetic field. ... Kozlov A.N. Plasma flow peculiarities in accelerator channel with longitudinal magnetic field. ... Kozlov A.N., Zaborov A.M. Formation of the current attachments in plasma accelerator channel under influence of the longitudinal magnetic field. ...
ELENA ROVENSKAYA RUSSIAN . ... Optimization and optimal control, dynamic systems, mathematical modeling in economics and ecology . ... Elena Rovenskaya's research aims at the theoretical elaboration of new methods for solving optimal control problems (both analytical and numerical), as well as at application of existing methods to solve economic, social and ecological problems. ... 2009) Rovenskaya E.A. To the Solution of an Optimal Control Problem with State Constraints by Doubled-variations Method. ...