... Доктор филологических наук профессор Юрий Николаевич МАРЧУК является видным специалистом по прикладной и компьютерной лингвистике , машинному переводу, автоматическому анализу и синтезу текстов, терминологии и терминоведению, лексикологии и лексикографии, общему языкознанию. ... Белов Алексей Михайлович, преподаватель, кандидат филологических наук . ... Качалкин Анатолий Николаевич, профессор, доктор филологических наук . Кочергина Вера Александровна, профессор, доктор филологических наук . ...
News of PARALLEL.RU par-news на mail.parallel.ru . ... Место проведения семинара будет опубликовано позже на сайте семинара http ://agora.guru.ru/parallel ------------- НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru / news / + Система визуализации Eureka на базе графических процессоров NVIDIA с пиковой производительностью 111 TFlop /s используется в Argonne Leadership Computing Facility для обработки данных с IBM Blue Gene/P. http ://www.anl.gov/Media_Center/ News / ...
... List of complexes . ... NPIDB, Nucleic acid ? Protein Interaction DataBase provides an access to structured and organized information about all available structures of DNA ? ... Since 2003, the database is available online. ... NPIDB: nucleic acid?protein interaction database . ... An updated version of NPIDB includes new classifications of DNA-protein complexes and their families . ... Sergey Vasilyev (the main developer of the first version of the database) . ... 03-04-48476 (2003 2005) . ...
... Chair of Computer Methods of Physics . ... Create new account (active tab) . ... Spaces are allowed; punctuation is not allowed except for periods, hyphens, apostrophes, and underscores. E-mail address * . ... The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. ... Department of Physics M.V. Lomonosov Moscow State University , Chair of Computer Methods of Physics , 2014 . ... Let us know ! ...
... Atmospheric and Oceanic Boundary Layer Physics V. Lykossov 3.1 Introduction The globe of the earth is surrounded by a gaseous atmosphere which is always in motion. ... One of the most important problems is the parameterization of the turbulent uxes of momentum, latent and sensible heat at the sea surface. ... In the atmospheric surface layer, typically the lower 10 % of the boundary layer, the turbulent uxes of momentum, water vapor and sensible heat are nearly constant with height. ...
... Hello everybody out there using minix - I'm doing a (free) operating system (just a hobby, won't be big and professional like gnu) for 386(486) AT clones. ... I'd like any feedback on things people like/dislike in minix, as my OS resembles it somewhat (same physical layout of the file-system (due to practical reasons) among other things). ... This implies that I'll get something practical within a few months, and I'd like to know what features most people would want. ...
Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia email: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the socalled V Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY YMP supercomputers. al structure of the program. ...
... We will dwell on linguistic aspects and Lexical Resources of POLITEXT branch having in mind some intermediate semantic representation of a whole text as the basis for differentiated Information Extraction. It is personal data (in the social sphere) recognition in texts that we focus on, see (Leontyeva et al. ... As the main instrument of semantic analysis of coherent texts this dictionary bears the important information on how to build BTF-units starting from lexemes of SemDict entries. ...
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы
Economic, industry and corporate trends A report from the Economist Intelligence Unit sponsored by Cisco Systems Foresight 2020 Economic, industry and corporate trends Contents Preface Executive summary Chapter 1: The world economy Chapter 2: Industries Automotive Consumer goods and retailing Energy Financial services Healthcare and pharmaceuticals Manufacturing Public sector Telecoms Chapter 3: The company Appendix I: Survey results 2 3 6 22 24 30 36 43 50 57 62 67 74 86 Appendix II: Methodology for
[
Текст
]
Ссылки http://bc.fdo.msu.ru/Nik_s/WorkFiles/DOC_files/World_shares_foresight_2020.pdf -- 425.8 Кб -- 20.03.2012 Похожие документы
Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...
[
Текст
]
Ссылки http://cell.biophys.msu.ru/static/announce/media/files/Force-induced_globule-coil_transition_in_laminin_binding_protein_and_its_role_for_viral-cell_membrane_fusion.pdf -- 1182.2 Кб -- 30.11.2015 Похожие документы
... ФИЗИКА АТМОСФЕРНОГО ОЗОНА . ... ЛАБОРАТОРИЯ ТЕОРИИ КЛИМАТА ИНСТИТУТА ФИЗИКИ АТМОСФЕРЫ ИМ. А.М. ОБУХОВА РАН . СЕКТОР ЧИСЛЕННЫХ ИССЛЕДОВАНИЙ ПО ФИЗИКЕ АТМОСФЕРЫ ГИДРОМЕТЦЕНТРА РОССИИ . ... На кафедре работает акустический локатор зондирующий пограничный слой атмосферы, на данных которого ведутся совместные с ИФА РАН научные исследования. ... Студенты кафедры физики атмосферы имеют возможность выполнять дипломную работу в Институте физики атмосферы им. А.М. Обухова РАН в Лаборатории теории климата. ...
Search of Novel Crystalline Materials , Study of their Properties and Crystallization Processes . ... The work of group for the search of novel crystalline materials are held at M.V. Lomonosov Moscow State University since 1964. The main aim of investigations are search and study of new promising multifunctional materials with unusual physical properties: ferroelectrics, superionic conductors, nonlinear optical materials, laser crystals, piezoelectrics, etc. ...
The beamer class Manual for version 3.06. \begin{frame} \frametitle{There Is No Largest Prime Number} \framesubtitle{The proof uses \textit{reductio ad absurdum}.} \begin{theorem} There is no largest prime number. \end{theorem} \begin{proof} \begin{enumerate} \item<1-| alert@1> Suppose $p$ were the largest prime number. \item<2-> Let $q$ be the product of the first $p$ numbers. \item<3-> Then $q+1$ is not divisible by any of them. \item<1-> Thus $q+1$ is also prime and greater than $p$.\qedhere
30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...
[
Текст
]
Ссылки http://cosrad.sinp.msu.ru/experiments/tus/doc/global2007.pdf -- 136.8 Кб -- 19.03.2008 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы