Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... 000, 113 (2010) Printed 21 September 2011 A (MN L TEX style file v2.2) A universal ultraviolet-optical colourcolourmagnitude relation of galaxies I1gor V. Chilingarian1,2, and Ivan Yu. ... Received 2011 Sep 15; in original form 2011 Feb 6 ABSTRACT The bimodal galaxy distribution in the optical colourmagnitude diagram (CMD) comprises a narrow "red sequence" populated mostly by early-type galaxies and a broad "blue cloud" dominated by star-forming systems. ...
Annu. ... Key Words stellar energy production, Nobel Prize, supernova, binary pairs s Abstract Astrophysics has been an important part of my personal and scientific life three times. ... Gamov suggested to one of his graduate students, Charles Critchfield, that he actually calculate the proton-proton reaction. ... In stars, the proton-proton reaction is usually followed by a chain of reactions with the end result of producing 4He. ... In 1938, they suggested energy production in stars. ...
... About choir . ... Conductor . ... Performance the Academic Choir of the Moscow State University in Crocus City Hall . ... Askerov Mirza-Aga Saftarovich , born in 1959, honored cultural worker of the Russian Federation, honored worked of the All-Russian Musical Society, candidate of pedagogical sciences. ... Since 1990 has been working with the Academic Choir of Moscow State University on the recommendation of professor V.V. Baranov, the honored cultural worker of the Russian Federation. ...
Economic, industry and corporate trends A report from the Economist Intelligence Unit sponsored by Cisco Systems Foresight 2020 Economic, industry and corporate trends Contents Preface Executive summary Chapter 1: The world economy Chapter 2: Industries Automotive Consumer goods and retailing Energy Financial services Healthcare and pharmaceuticals Manufacturing Public sector Telecoms Chapter 3: The company Appendix I: Survey results 2 3 6 22 24 30 36 43 50 57 62 67 74 86 Appendix II: Methodology for
[
Текст
]
Ссылки http://bc.fdo.msu.ru/Nik_s/WorkFiles/DOC_files/World_shares_foresight_2020.pdf -- 425.8 Кб -- 20.03.2012 Похожие документы
... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...
Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...
... On-line консультант . ... Приглашаем всех, интересующихся исследованиями и разработками в области компьютерных сетей, принять участие в семинаре по software-defined networking, который состоится 4 июля 2011 (понедельник) в 19.30 в Политехническом музее (Новая площадь, д 34;, подъезд 9, малая аудитория). ... We are about to witness a revolution in the networking towards so-called "Software Defined Networking" (SDN). SDN enables innovation in all kinds of networks . ... Copyright ВМиК МГУ , 2008 . ...
... Использование which и that в относительных придаточных предложениях . Придаточное предложение, начинающееся со слова that , всегда является ограничивающим, т.е. такое придаточное предложение запятыми не выделяется. ... Здесь неограничивающий случай: придаточное предложение фиксирует дополнительную, уточняющую информацию о decimal fractions . ... придаточное предложение является ограничивающим, поскольку оно указывает, какие именно decimal fractions correspond to rational numbers . ...
... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...
О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...
[
Текст
]
Ссылки http://hit-conf.imec.msu.ru/2012/abstracts/AbstractKonyukhovLikhachev.doc -- 263.5 Кб -- 14.06.2015 Похожие документы
... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...
... ADSP2181 Data Sheet. ... ********************* ********* * * This sample program is organized into the following sections: * * Assemble time constants * Interrupt vector table * ADSP 2181 intialization * ADSP 1847 Codec intialization * Interrupt service routines ********************************************************* ********* .module/RAM/ABS=0 loopback; {************* ... transmit i? 68 |||! |||! |||+============= control bit ||+-------------|+--------------control bit +---------------- ! ...
JOURNAL OF APPLIED PHYSICS 100, 033718 2006 Transition between N- and Z-shaped current -voltage characteristics in semiconductor multiple- quantum - well structures O. V. Pupyshevaa Institute for Materials Research, Tohoku University, Sendai 980-8577, Japan and Department of Low Temperature ... -8577, Japan Received 17 January 2006; accepted 17 June 2006; published online 14 August 2006 We study theoretically the vertical electron transport in semiconductor multiple- ... Phys. Lett. ...
Lomonosov Moscow State University FACULTY OF ARTS 2011 ALEXANDER LOBODANOV DEAN OF THE FACULTY OF ARTS WxtЊ vҐЂЂxtzтxс4 g{x YtvтЂрч Ґy TЊрс уxЊx tvvx¶рxw |° ... Since 2003 he has been chairman of the Department of Semiotics and the General Theory of History, founded by him, the first of its kind in Europe. ... Department of Semiotics and the General Theory of Arts The Department of Semiotics and the General Theory of Arts is a theoretical department. ... Galina Zadneprovskaya manages this department. ...
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы
Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...
... Unit I. Geologic Hazards and Man Unit II. ... Amazing Earth. ... Трансформируйте словосочетания в предложения. 1. geologic processes going on for millions of years 2. any geologic process can become a geologic hazard 3. some geologic hazards having resulted in disaster 4. many geologic hazards have affected the activity of man 5. a lot of earthquakes resulting in landslides 6. some naturally occurring hazards 7. many disasters are caused by geologic hazards 8. some ...
[
Текст
]
Ссылки http://www.geol.msu.ru/obsh/uch_ch2.doc -- 389.0 Кб -- 08.04.2016
[
Текст
]
Ссылки http://geol.msu.ru/obsh/uch_ch2.doc -- 389.0 Кб -- 08.04.2016 Похожие документы