... Inorganic Materials Sciences . ... At the same time at the Faculty of Physics and Mathematics of the Moscow University was founded the Inorganic Chemistry Division which was later transformed into a separate Department of Inorganic Chemistry of the MSU Faculty of Chemistry . ... The latter part of this program is successfully realized at both the Deartment and at the Department of Materials Sciences , the new faculty of MSU, which creation was initiated by the department of Inorganic Chemistry. ...

Еще в разделе: (Показать все результаты (>40) - www.inorg.chem.msu.ru/ )

Samsung Advanced Institute of Technology (http://www.sait.samsung.com/eng/about/e_index.jsp) SAIT is the Corporate Research Organization of Samsung Electronics Co., Ltd., ... Our aim is to foster a boundless exploration of sciences and technology, and SAIT offers an exciting and highly competitive research environment. SAIT is inviting outstanding individuals with leadership and creative thinking to our Recruiting Session. ... Contact Information: +82-31-280-8108, saitglobal@samsung.com ...

Еще в разделе: (Показать все результаты (>91) - www.msu.ru/ )

• MSU Web Sites
• Alexander Vladimirovich SIDOROVICH - Pro-Rector
• Faculty of Fine and Performing Arts

... ОТЧЕТЫ СТУДЕНТОВ О ПРАКТИКЕ В САО . Лето 2001 года . ... Гришатовой Юлии . ... Для определения лучевых скоростей, FWHM (полной ширины на половине максимума) и интенсивности линия He I 6678.15А описывалась гауссианой ( рис.1 ). ... create/icat {P1} ztsh*.bdf . execute/catalog @@ set_lambda {P2} . execute/catalog @@ timing {P2} . execute/catalog @@ phase {P2} . ... create/table {P1}.tbl . ... create/column {P1}.tbl fwhm . execute/catalog @@ add_rv_curve_point {P2} {P1}.tbl . ...

Еще в разделе: (Показать все результаты (>15) - heritage.sai.msu.ru/ )

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

• Best search engines for finding scientific information in the Internet:

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...

Еще в разделе: (Показать все результаты (>3) - dionis.sai.msu.ru/ )

... Kkimiya UDC 547.821 DATABASE COVERING THE SYNTHESES OF PYRIDINE S FROM ACYCLIC REAGENTS: THE ROLE OF NONSTANDAR D RETRIEVAL REQUESTS I N DEVELOPING THE STRATEGY OF COMPUTER SYNTHESIS E. V. Babaev and S. V. Tsitovskii Th e methodolog y o f constructin g a databas e covering th e synthese s o f pyridin e ring i n a standar d ChemBas e shel l i s discussed . ... Double lines in the diagrams correspond to the skeleton bonds of the reagents that pass into the skeleton of the pyridine cycle. ...

Еще в разделе: (Показать все результаты (>140) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/032e.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Publications . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Lomonosov Moscow State University . ... Publication type . Conference paper . ... Publication date . ... Conference . 17-th International Conference on Computer Graphics GraphiCon'2007 . ... Moscow, Russia . ... BookTitle = {17-th International Conference on Computer Graphics GraphiCon'2007}, . ... Address = {Moscow, Russia}, . ...

Еще в разделе: (Показать все результаты (>264) - imaging.cmc.msu.ru/ )

• Ringing analysis - database | Laboratory of Mathematical Methods of Image
• Basic edges | Laboratory of Mathematical Methods of Image Processing
• Ringing effect modeling | Laboratory of Mathematical Methods of Image...

Magnetism Department MSU . ... Magnetism department . ... Magnetic Laboratory was created in Moscow State University by professor Vladimir Arkad ev. ... In 1918 Arkad ev returned in MSU where he founded Moscow Magnetic Laboratory, which exists for a long time on the enthusiasm of their members. ... As the head of new department professor Nikolay Akulov was assigned. ... During the period since 1954 till 1987 the head of magnetism division was Eugeny Kondorsky. ... Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>24) - magn.phys.msu.ru/ )

... April 9, 1999 . WR 104: Pinwheel Star . ... Explanation: Like a cosmic lawn sprinkler, dust streaming from a rotating star system creates a pinwheel pattern in this false color infrared image . Astronomers discovered the surprising star dust scenario using a sophisticated interferometer and the 10 meter Keck I telescope to observe the bright Wolf-Rayet star WR 104. ... The problem is, their starlight would also be so intense that any dust flakes should be destroyed! ... About APOD > . ...

Еще в разделе: (Показать все результаты (>43) - www.arcetri.astro.it/ )

• APOD: November 9, 1999 - Spiral Galaxies in Collision
• APOD: 2000 September 28 - Heating Coronal Loops
• APOD: 2000 September 6 - Emerging Planetary Nebula CRL 618

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. ... April 11, 2013 - Bashneft Group in conjunction with JSFC "Sistema" opened the programme for the development of key Bashneft Group management - School of CEOs, "Capsule of security". ... At the end of his Welcoming Speech President of Bashneft Group stressed that this programme ? ... The School of CEOs ? ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>28) - hsmi.msu.ru/ )

• Admission committee | MSU Higher school of management and innovation
• School overview | MSU Higher school of management and innovation
• MSU Higher school of management and innovation |

Organized by the European Physical Society in cooperation with the European Networks of Excellence, "Phoremost" (nanophotonics), "Metamorphose" (meta-materials) and "Plasmon Nano Devices" The Conference will feature contributed oral and poster papers and talks invited at the discretion of the Program Committee. Paper submission deadline: 15 September 2006. ...

Еще в разделе: (Показать все результаты (>168) - phys.msu.ru/ )

• Title
• Physics Faculty News

Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...

Еще в разделе: (Показать все результаты (>25) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

Еще в разделе: (Показать все результаты (>3) - saistud.sai.msu.ru/ )

Given word length and max number of mismatches . Use MEME algorithm for define conserved blocks . Apply the Dynamic programming algorithm to create chain of the blocks . Refine the chain using combined profile for chain of blocks. ... Reduce word length and number of mismatches and repeat the procedure for spacer between the blocks. ... Create helix profile and apply MEME-like iterative procedure to find sets of helices that consistent lokated reative to conserved blocks . ...

Еще в разделе: (Показать все результаты (>8) - bioinf.fbb.msu.ru/ )

... Main page News People . ... Master net Homepage . ... SAI MSU 20-21 March 2014 . ... Zel'dovich asteroid . ... YaB-100 conferences . ... Science committee: . ... E.S. Gorbovskoy (SAI MSU) . V.M. Lipunov ( chairperson, MSU, SAI) . G.V. Lipunova (SAI MSU) . ... M.V. Pruzhinskaya (SAI MSU) . A.M. Cherepashuk (MSU, SAI) . N.V. Tyurina (SAI MSU) . N.I. Shakura (SAI MSU) . ... The conference is organized by the Zel'dovich Moscow Astrophysics Seminar ( master.sai.m su.ru/osa/ ) . ...

Еще в разделе: (Показать все результаты (>39) - master.sai.msu.ru/ )

• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>13) - ecoinformatica.srcc.msu.ru/ )

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>174) - www.pereplet.ru/ )

... MSU Chamber Orchestra . ... Chamber Orchestra of Moscow State University was born in 1967. ... It was originally formed as a chamber orchestra at the School of Mathematics and Mechanics but soon (since September 1967) transformed into a Chamber Orchestra of the Moscow State University. ... The Chamber Orchestra of Moscow State University won the first prizes in the 1-st and 2-nd All-Union festivals of non-professional arts. ... Moscow State University does not have its own School of Music. ...

Еще в разделе: (Показать все результаты (>85) - music.genebee.msu.ru/ )

... Project developer: Serguey Lonchakov, 4th year student, and Serguey Azarkin, 3rd year student . ... The project is working on creating a robot-platform which performs hopping movement, an absolutely new principle of movement for automatons. ... However, if for an adult walking, running, jumping or climbing do not seem to cause any problem, but two-legged robots have just caught up with average speed of a human being, and that is after 20 years of work. ... And the robot started hopping. ... Jumping ...

Еще в разделе: (Показать все результаты (>64) - engineering.phys.msu.ru/ )

• Circuit Diagnostics
• Beginning of the classes
• Meeting with the representatives of Argentine