Copyright . The following is a notice of limited availability of the code, and disclaimer, which must be included in the prologue of the code and in all source listings of the code . DVM-system is Copyright 1999 by KIAM RAS . Keldysh Institute for Applied Mathematics of Russian Academy of Sciences), . ... This software is provided 'as-is', without any express or implied warranty. In no event will the author be held liable for any damages arising from the use of this software. ...

Еще в разделе: (Показать все результаты (>93) - sp.cs.msu.ru/ )

• DVM-system. Goals and structure
• DVM system - in English

... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>9) - ani.cmc.msu.ru/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Nanocrystalline materials based on metal oxides for the detection of toxic and hazardous gases in the air. ... sensorovEst material group hopes that the new materials developed at the Faculty of Chemical laboratory "Chemistry and physics of semiconductor and sensor materials " will substantially increase the artificial olfaction. ... Acetone Sensing by Modified SnO 2 Nanocrystalline Sensor Materials. ...

Еще в разделе: (Показать все результаты (>33) - www.lssm.inorg.chem.msu.ru/ )

... Форумы > Аспирантура > Тема . Автор темы gahsek . Форумы Список тем Новая тема . ... Phd positions at the Max-Planck Institute for Mathematics, Germany . ... в этом году обьявлен конкурс Phd позиций (до 10 мест): . http://www.imprs-mis.mpg.de/positions.html . ... Следующая тема Предыдущая тема . ... Извините, только зарегистрированные пользователи могут публиковать сообщения в этом форуме. ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>176) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | Аспирантура ин-т Макса Планка / ун-т
• MMOnline | Форумы | Преподаватели | Выложены лекции по ОПУ 2-поток 4 курс.
• MMOnline | Форумы | Аспирантура

... Conferences . ... International Scientific Conference "Probability Theory and its Applications" on Occasion of the 85-th Birthday of Yu.V.Prokhorov is organized by the Steklov Mathematical Institute , Faculty of Computational Mathematics and Cybernetics of Moscow State University , and Institute for Informatics Problems of Russian Academy of Sciences from 12 to 14 of February, 2015. ... CMC MSU students at GSIS Summer School, Tohoku University, Japan . ... CMC MSU тИТ GSIS Tohoku IT Joint Seminar . ...

Еще в разделе: (Показать все результаты (>110) - en.cs.msu.ru/ )

• Department of System Programming | CMC MSU
• Laboratory of Industrial Mathematics | CMC MSU

... Change password . Please enter the checkword and your new password . Login . Checkword . New password Confirm password . Recover password . ... Please log in. ... Password . ... Forgot password? Password request . Send me checkword . ... E-mail . ... If you cannot remember your password, enter your login or e-mail you have used for registration. A message containing the check word you can use to change the password will be sent to your e-mail. ... One-time password . ...

Еще в разделе: (Показать все результаты (>3) - www.ffl.msu.ru/ )

• Get Password - Факультет иностранных языков
• Authorization - Факультет иностранных языков

: .., . . , . (e-mail: volnatmax@mail.ru) , , movements, Formation, forms , social , . . In the article formation process of social movements in Russia is considered, its forms and mechanisms are defined. Specific features of development of movements come to light.

Еще в разделе: (Показать все результаты (>69) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2012/3/07.pdf
• http://www.socio.msu.ru/vestnik/archive/2011/4/10.pdf
• http://www.socio.msu.ru/vestnik/archive/2012/2/04.pdf

Academy of Science, Engineering and Technology International Journal of Chemical, Nuclear, Metallurgical and Materials Engineering Vol :8 No:10, 2014 Kohonen Self-Organizing Maps as a New Method for Determination of Salt Composition of Multi-Component Solutions Sergey A. Burikov, Tatiana A. Dolenko, Kirill A. Gushchin, Sergey A. Dolenko Abstract--The paper presents the results of clusterization by Kohonen self-organizing maps (SOM) applied for analysis of array of ... T I. INTRO DUCTION water. ...

Еще в разделе: (Показать все результаты (>27) - rswater.phys.msu.ru/ )

• http://rswater.phys.msu.ru/Assets/Water/ICANN_manuscript.pdf
• Laboratory of laser spectroscopy of solutions of supramolecular compounds and

... Anatoliy A. Polikarpov . ... In the submitted paper, first, there are present some basic points of an evolutionary model for understanding the logic of word-formational process responsible for arising of general word/morpheme length regularities and, second, some Russian language data (50787 Russian root and affixed words) for the initial testing of the model. ... Empirically revealed oscillative character of general dependence of suffixes' length on their positional numbers is also explained. ...

Еще в разделе: (Показать все результаты (>48) - old.philol.msu.ru/ )

• HumLang - Human Language
• Basic Assumptions about a Sign's Life Cycle for Mathematical Modelling of
• MSU-LGCLL:: Anatoliy A. Polikarpov - Some Factors and Regularities of

Lomonosov project . ... Personnel . ... Affiliation D.V. Skobeltsyn Institute of Nuclear Physics of M.V. Lomonosov Moscow State University . ... Phone 7 495 939 1818 . ... Phone 7 495 939 5731 . ... Phone 7 495 939 1010 . Fax 7 495 939 0896 . ... Affiliation Moscow State University, Sternberg Astronomical Institute . ... Fax 7 495 939 5063 . ... Institute for Biomedical Problems of the Russian Academy of Sciences, Skobeltsyn Institute of Nuclear Physics of Moscow State University. ...

Еще в разделе: (Показать все результаты (>34) - lomonosov.sinp.msu.ru/ )

• Collaboration | Университетский спутник "Ломоносов"
• Scientific equipment | Университетский спутник "Ломоносов"

... In 1964 at the Institute of Mechanics of Lomonosov Moscow State University the laboratory of physical-chemical gasdynamics had been set up under the supervision of Tirskiy G.A., which employed a team of three scientists - Tirskiy G.A., Gershbein E.A., Suslov O.N.; before they worked in the general hydromechanics division. ... V.N. Chelomey Medal of Astronautics Federation of Merit for the National Astronautics (2004, Kovalev V.L., Sakharov V.I., Tirskiy G.A.). ...

Еще в разделе: (Показать все результаты (>9) - lab106.imec.msu.ru/ )

... PhD student needed in the Institute of Physical Chemistry in Warsaw, Poland for a study involving mostly calculations and NMR measurements of strained hydrocarbons with unusual spatial structure. ... As can be seen in the webpage, the group is also involved in studies in supramolecular chemistry and, if interested, the student could also take part in this research. ... The entrance exam is based on "Physical Chemistry" by Atkins. ...

Еще в разделе: (Показать все результаты (>22) - www.chemport.ru/ )

• Consumers expectations relating premium beer brands the research prepared on

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...

157. http://swx.sinp.msu.ru/models/database/modules/about.php

158. http://phys.msu.su/upload/iblock/04a/announc_eng.doc

159. http://nanofluidics.phys.msu.ru/paper/pf2007.pdf

160. http://www.suny.msu.ru/en/CyberCon05En.doc