... Each July we ::. to Turkey for a holiday. are going . ... He ::: quite different since we :: married. is/has got . ... What time:::tomorrow? . ... If you ::. careful with electricity, you might get a shock. don't . ... had got to get . ... There were too much . ... b) What do you use your computer for? . ... g) Do you see yourself as a computer geek ? ... But as a true technobimbo , I really hate the way computers get stuck, go wrong and generally fail to explain themselves in plain English. 4. ::::...

Еще в разделе: (Показать все результаты (>19) - www.eng.math.msu.su/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

. Our Atlas server news 1 (Feb 06, 2008) [Rus, utf-8] .

Еще в разделе: (Показать все результаты (>10) - lhe.sinp.msu.ru/ )

... With the usage of on-land and satellite altimetrical measurements data some gravity map were made, averaged on one degree trapeziums, in reductions Faja, Bouguer, Glenni, which were included in the geological-geophysical international atlases of Atlantic, Indian and Pacific oceans. ... Boldirev S.A., Gajnanov A.G., Stroev P.A. Dencital inhomogeneities in lithosphere and dynamics of development of the North-West part of the Pacific mobile belt. ... Moscow, Nedra edition, 1967. ...

Еще в разделе: (Показать все результаты (>64) - geophys.geol.msu.ru/ )

• Near-surface electrical prospecting laboratory at Moscow University
• Researchs
• Software for resistivity and induced polarization

... On-line консультант . ... Место работы, должность: Преподаватель, старший научный сотрудник Лаборатории Вычислительных комплексов ВМК МГУ имени М.В.Ломоносова . ... D. Gamayunov, R. Smeliansky. ... 2002. (in Russian) . D. Gamayunov, A. Kachalin. ... In proceedings of the fifth Russian Applied and . ... detectors of computer attacks for corporate networks. ... I. Bulgakov, D. Gamayunov, E. Toroschin, Detecting network worms . ... Опыт работы по тематике магистратуры: 9 лет (руководство . ...

Еще в разделе: (Показать все результаты (>8) - erp.cmc.msu.ru/ )

docs ]] . CompHEP . Trace: docs . ... E.E.Boos, M.N.Dubinin, V.A.Ilyin, G.V.Jikia, A.E.Pukhov, S.F.Sultanov, Associated Higgs boson production in $\gamma e$ collisions, Puzzles on the Electroweak Scale. ... E.E.Boos, M.N.Dubinin, V.F.Edneral, V.A.Ilyin, G.V.Jikia, A.E.Pukhov, V.I.Savrin, S.A.Shichanin, S.F.Sultanov, Physics on future $\gamma p$ and $\gamma e$ colliders at TeV energy scale and computer system CompHEP, DESY report 91-114, Hamburg, 1991, 24p . ... Higgs boson production . ...

Еще в разделе: (Показать все результаты (>13) - comphep.sinp.msu.ru/ )

... Научный календарь МГУ Научная жизнь на ФГУ Конференции Научные семинары Международная конференция ФГУ International Conference Молодым ученым Электронные ресурсы Список полнотекстовых баз данных (журналы) Список полнотекстовых баз данных (книги) Список реферативных баз данных Материалы международных конференций Архив мероприятий Конференции Научные семинары Круглые столы Презентации Международная конференция ФГУ Фестиваль науки Международное сотрудничество . ... Agricultural and Biological Sciences ...

Еще в разделе: (Показать все результаты (>29) - www.spa.msu.ru/ )

... T. A. Dolenko, S. A. Burikov, K. A. Laptinskiy, and O. E. Sarmanova, Improvement of the fidelity of molecular DNA computations: control of DNA duplex melting using Raman spectroscopy, Laser Physics, v. 26, No 2 Jessica M. Rosenholm, Igor I. Vlasov, Sergey A. Burikov, Tatiana A. Dolenko, and Olga A. Shenderova. ... A.O. Efitorov, S.A. Burikov, T.A. Dolenko, I.G. Persiantsev, S.A. Dolenko. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>23) - rswater.phys.msu.ru/ )

• Лаборатория лазерной спектроскопии растворов супрамолекулярных соединений и

... American), headings and the style of referencing. ... The opening page of a contribution in the NATO book series should always be a right hand page and should consist of: the title in capital letters, bold font, flush left, on the fourth text line; followed by the subtitle (if present) in italics, flush left, with one line of white above. ... First-order Heading This heading is in bold, upper and lowercase letters, numbered in arabic figures, and has two lines of space above and one line below. ...

Еще в разделе: (Показать все результаты (>82) - mgumus.chem.msu.ru/ )

... Basic statement: "Mathematics is much clever, than Mathematician" It means, that after the scientist or engineer developed new mathematical model and designed corresponding equations, the solution to these equations produces new information unpredictable for the author! ... This vibration excites the shear wave in tissue 2 sx 2 - (ct + ) s x = Fx 2 t t Studies in Fluid Dynamics of water jet are connected with two main problems: 1. Flows in contracting nozzle forming high-speed jet. ...

Еще в разделе: (Показать все результаты (>50) - acoustics.phys.msu.ru/ )

... PyMol is a powerful drawing instrument and here we show how to plot Fukui function with PyMOL after two calculation steps with FireFly (PC-GAMESS). ... Because total HOMO orbital have two electrons and should be divided by two (see equations at the beginning). 1 комментарий " Building and plotting Fukui function with FireFly and PyMol " . Quantum chemistry information page ERG Research Group: Лаборатория теоретической биофизики написал (Май 20th, 2015 12:43 пп) . ... 2014 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>21) - erg.biophys.msu.ru/ )

• Reaction-diffusion systems in 2D space with python ERG Research Group: