... On the Institute . ... Development of relational methods of studying time [Chief: V.V. Aristov, Dr. Sci. (physics and mathematics)] . ... Physics of relic radiation, fundamental interaction mediator, carrier of space and time [Chief: I.M. Dmitrievsky, PhD (technology), Ass. ... Algebraic structure of space-time, algebrodynamics of fields and particles [Chief: V.V. Kassandrov, PhD (physics and mathematics)] . ... Causal mechanics [Chief: S.M. Korotaev, Dr. Sci. (physics and mathematics)] . ...

Еще в разделе: (Показать все результаты (>23) - temporology.bio.msu.ru/ )

... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... Вакансии . ... Employed as Intern (temporary contract), to be based in HP Moscow . Assist Open Innovation Office (OIO) Russia Regional Lead to run HP Institute of Technology (HP.I.T.) Program in Russia and CEE region (Central Eastern Europe) . Help to establish new HP IT Centers in target Universities in Russia and CEE . ... Organise branding of HP.I.T. Centers in target Universities . ... Ability to travel (Russia / CEE) . ...

Еще в разделе: (Показать все результаты (>91) - www.physcareer.ru/ )

• Key Account Manager Financial Institution and Alternative Distribution (Code -
• Technical Consultant, Solutions Infrastructure Practice (Graduate) / Вакансии /

... Astronomy search engine . ... PhysicsWeb Home Page . ... Sternberg Astronomical Institute . ... Astro Space Center Home Page . ... Landau Institute for Theoretical Physics . ... Astronomy and Space Physics Dept of Kiev University . ... NATIONAL RADIO ASTRONOMY OBSERVATORY Home Page . University of Hawaii - Institute for Astronomy . ... Space Telescope Science Institute Home Page . ... Sky & Telescope: The Essential Magazine of Astronomy . ... Springer LINK - Physics Online Library . ... Home . ...

Еще в разделе: (Показать все результаты (>201) - astro.uni-altai.ru/ )

Moscow State University . INTERNATIONAL CONFERENCE . ... Moscow, Russia . ... Institute of Mechanics of MSU . ... The aim of this Conference is gathering active researchers and students in the field of nonlinear fluid dynamics in order to provide a forum for discussions. Since 1976 through 2008 the Conference was organized by the Institute of Mechanics of Moscow State University (see http://hit2003.narod.ru/ ). ... Institute of Mechanics , Moscow State University . ...

Еще в разделе: (Показать все результаты (>32) - hit-conf.imec.msu.ru/ )

• Untitled
• Moscow 2006

... Co-Chair , ICONO/LAT 2013 . Director, Institute of Laser Physics . ... Russia . ... Conference venue . Moscow, Russia . Program overview . Program topics . ... Advance program . ... Visa to entry Russia . ... ICONO/LAT conference is the leading event in the area of quantum electronics, laser physics, and their applications. ... You are greatly welcome to attend the ICONO/LAT 2013 conference in Moscow, Russia. ... International Laser Center, M.V.Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>13) - iconolat13.phys.msu.ru/ )

• Invited speakers

Alexander S. Antonov . ... M.V.Lomonossov Moscow State University . ... June 4, 1999, Moscow State University . ... 1994-2000: programmer, Laboratory of Parallel Information Technologies, Research Computer Center, Moscow State University . ... A.S. Antonov, A.M. Teplov. ... Antonov A.S., Voevodin Vl.V., Sobolev S.I., Filamophitskiy M.P. Internet-Auditorium of Lomonosov Moscow State University // Abstracts of the All-Russian scientific conference "Scientific Services Internet" (Novorossiysk, 2000). ...

Еще в разделе: (Показать все результаты (>8) - asa.guru.ru/ )

... Along with the stable inner proton belt, temporal variations of the 1-15 MeV protons at L=2.5-3.5 have been reported, with intensity increases and decreases registered during and after strong magnetic storms. ... Our study presents experimental evidences that creation and destruction of solar proton belts in the inner magnetosphere may be produced by the fast shifts of the proton penetration boundary without additional acceleration and injection. ... Black line shows the 50-90 MeV proton profiles. ...

Еще в разделе: (Показать все результаты (>88) - www.kosmofizika.ru/ )

• Institute of Solar-Terrestrial Physics RAS SB
• Frequently Seen Space/Astronomy Acronyms
• CURRICULUM VITAE

Hybrid Molecular Mechanics : For Effective Crystal Field Method for Modeling Potential Energy Surfaces of Transition Metal Complexes M. B. DARHOVSKII/-2 M. G. RAZUMOV/ A. L. TCHOUGREEFF12 1 3 I. V. PLETNEV,2' 4 L. Y. Karpov Institute of Physical Chemistry , Moscow , Russia 2 Center for Computational Chemistry at the M. V. Keldysh Institute/or Applied Mathematics of RAS, Moscow , Russia 3N. S. Kurnakov Institute of General and Inorganic ... 2002 Wiley Periodicals, Inc. ...

Еще в разделе: (Показать все результаты (>29) - analyt.chem.msu.ru/ )

• Moscow State University: Analytical Chemistry Division

... In particular, for "symmetric weights" we have a (x)f (x) dx, where (x) is an even weight function; the degree of the polynomial for the calculation of -a weights is decreased by two times, more precisely, P (x) = x f (x2 ), where P (x) is the polynomial of degree m = 2k + , k = [m/2], for determination of the weights, f (x) is a polynomial of degree k (here [... ] is the integral part). ... Now consider particular weight functions and calculate the formulas of the 10th and 14th orders of accuracy. ...

Еще в разделе: (Показать все результаты (>44) - shamolin2.imec.msu.ru/ )

... Роджер Пэнг (љ Roger Peng) на своем youtube-канале выложил видео 4х недель своего курса ?Computing for Data Analysis? Week 1 : . ... Data Types . ... Reading/Writing Data: Part 1 . ... The ?str? function . ... Writing Functions . ... The mapply function in R . ... Using the apply function in R . ... Plotting (base graphics) . ... Plotting with lattice . ... IBM SPSS Statistics 20 и AMOS: профессиональный статистический анализ данных Самые важные научные исследования последнего десятилетия. ...

Еще в разделе: (Показать все результаты (>8) - tukachev.flogiston.ru/ )

• Category: Новости
• Tag: R

... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...

Еще в разделе: (Показать все результаты (>3) - sa.cs.msu.ru/ )

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>3) - www.eng.geogr.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Sign in Register . ... Resources . ... Blog . 495) 3334-65-56 . info@ecfs.msu.ru . All contacts . ... E-mail * . Password * . ... Confirm password * . ... The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. Provide a password for the new account in both fields. ... Contacts . The Department of land resources . ...

Еще в разделе: (Показать все результаты (>17) - ecfs.msu.ru/ )

• Communication and Information Department | ECFS
• The Department of land resources | ECFS

... Second-year students classes . ... The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... As a result, by the and this course, students acquire knowledge about the popular parallel programming techniques, knowledge of modern high-performance computing systems and practical skills to work with them. ... Moscow: Binom...

Еще в разделе: (Показать все результаты (>78) - engineering.phys.msu.ru/ )

• Microcontroller Programming

... In 1964 at the Institute of Mechanics of Lomonosov Moscow State University the laboratory of physical-chemical gasdynamics had been set up under the supervision of Tirskiy G.A., which employed a team of three scientists - Tirskiy G.A., Gershbein E.A., Suslov O.N.; before they worked in the general hydromechanics division. ... V.N. Chelomey Medal of Astronautics Federation of Merit for the National Astronautics (2004, Kovalev V.L., Sakharov V.I., Tirskiy G.A.). ...

Еще в разделе: (Показать все результаты (>9) - lab106.imec.msu.ru/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... MIT (Massachusetts Institute of Technology) free library materials . ... Re: MIT (Massachusetts Institute of Technology) free library material [ re: Jilimili ] . ...

Еще в разделе: (Показать все результаты (>1390) - www.snto-msu.net/ )

• Продам computer без блока питания и HDD - Public forum of MSU united student
• Объявления о PhD, Postdoc, Schools, Confs etc. - Public forum of MSU united
• For sale: AMD AM2 4000+ based computer + Asus flat display 22" - Public forum

... Graduated in 1963 from the Faculty of Mechanics and Mathematics (Moscow State University). ... Honorary Doctor of Tokai University (Japan), Honorary Doctor of Istanbul University (Turkey), Honorary Doctor of Mongolian University , Honorary Doctor of Hanoi National University (Viet-Nam), Honorary Doctor of Byelorussian State University , Honorary Doctor of Yerevan University (Armenia), Honorary Doctor of Tashkent University (Uzbekistan), Honorary ...

Еще в разделе: (Показать все результаты (>181) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Вестник

... The article introduces the notion of public governance analytics as the set of instruments and results of public governance practice analysis, and of proposals for practice of governance improvement. Main requirements for analytics of public governance are defined. The notion of public governance as scientific research area, based on theories of public administration, new public management, public governance, and utilizing the instrumental methods of research, is also introduced. ...

Еще в разделе: (Показать все результаты (>225) - ee-journal.spa.msu.ru/ )

Копировать из putty текст в буфер обмена и обратно . ... Например, если неправильно ввели в интерактивном режиме программы EMBOSS какой-нибудь параметр и не хотите продолжать - зарубите ее, нажав Ctrl-C. Вызывать аналог far (Midnight Commander) прямо в putty . ... less . Искать в less какое-нибудь слово . ... Чтобы выйти из less, надо нажать q. Напоминаю также, что когда вы говорите "man что-то" или "tfm что-то", то текст руководства у вас тоже показывается в less, так что слеш можно использовать. ...

Еще в разделе: (Показать все результаты (>2834) - kodomo.fbb.msu.ru/ )

• allpy: 80043822a41e
• allpy: 80043822a41e allpy/dna.py
• allpy: 80043822a41e SETPATH