... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...
... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Geography of World Economy . ... Cryolithology and Glaciology . ... Departments . ... Research laboratories . ... Field stations . ... Type of field courses . ... Department of Cryolithology and Glaciology The Department was founded in 1945 with the name Department of northern countries . ... Our students are active members of PYRN (Permafrost Young Researchers Network), in which they share best practices, information about conferences, field courses, jobs. ... ISBN 5-89176-095-9 . ...
In Silico Biology 3 (2003) 197204 IOS Press 197 The Channel in Transporters is Formed by Residues That Are Rare in Transmembrane Helices Olga V. Kalinina1,*, Vsevolod J. Makeev1, Roman A. Sutormin1, Mikhail S. Gelfand1,2 and Aleksandra B. Rakhmaninova2 1 2 State Scientific Many genes encoding known or putative transport proteins are found in bacterial genomes. ... It is based on the analysis of amino acids frequencies in bacterial secondary transporters. ... Proteins 51, 8595. ...
[
Текст
]
Ссылки http://storage.bioinf.fbb.msu.ru/~roman/insilicobiol_2003.pdf -- 411.4 Кб -- 21.12.2005 Похожие документы
Special courses for the students of Physics Faculty, specialized at the Department. ... 32 hours, 6-th term . ... A review of characteristic ferroelectric and magnetic materials is given. ... The anomalies of physical properties in the phase transition in accordance with the crystal symmetry. ... Solid state physics . ... It is assumed that student will get knowledge about magnetic properties of such systems as molecular, clusters, nano-particles, surfaces, ultra thin films, mono- and multilayers. ...
Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...
... Keywords: boundary-layer depth, stable stratification, Ekman layer. ... Experimental data (23) Data sets used in this paper for empirical validation of the proposed SBL depth formulation are taken from three measurement sites ( Figure 1), namely, (i) Cabauw measurement station (Nieuwstadt, 1984; Van Ulden and Wieringa, 1996), (ii) BASIS (Baltic Air-Sea-Ice Study) field experiment (Launiainen, 1999), and (iii) ETH-Greenland expedition in summer 1991 (Ohmura et al., 1992). (i) Cabauw ...
... Русский English . Background . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Each of FBB students is to successfully complete and defend three yearly research projects, in bioinformatics, biochemistry, and bioengineering. ...
... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...
Another mechanical model of parametrically excited pendulum and stabilization of its inverted equilibrium position Anton O. Belyakov 1 Lomonosov Moscow State University 2 Vienna University of Technology 8th European Nonlinear Dynamics Conference (ENOC 2014) Vienna, July 7, 2014 Scheme of a parametric pendulum y O l (t ) - g m 2 r1 + m 2 Equations of motion mr 2 1 d d2 + c1 + m g l (t ) sin () = 0 dt 2 dt (1) Dimensionless equation Three dimensionless parameters and ...
[
Текст
]
Ссылки http://belyakov.imec.msu.ru/papers/ENOC2014Presentation.pdf -- 707.6 Кб -- 26.09.2014 Похожие документы
... Two-dimension linear regression model. ... The econometric modeling of time series . ... The course aims to provide students with basic models and methods of econometric modeling of financial time series. ... The course considers in detail the major methods of econometric modeling of time series, in particular modeling by stochastic processes, modeling of stationary and non-stationary time series, the spectrum analysis of time series. ... The problem of tax optimization under a given state budget. ...
... Department of Vertebrate Zoology . PhotoGallery 'Field Practice at the White Sea' . The White Sea Biological Station is located on the very coast of Kandalaksha Bay of the White Sea. ... The Vertebrate Zoology course with Dr. Sergei V. Ogurtsov (assoc. prof. of the Department of Vertebrate Zoology) describes the biodiversity and the variety of ecological groups of vertebrates of the White Sea region through the methods of species recognition by songs, tracks, fecal pellets etc. ...
Школы-конференции . Алгебры Ли, алгебраические группы и теория инвариантов . 8 июня - 15 июня 2009 г., Самара . 31 января ? 5 февраля 2011 г., Москва . ... 27 января - 1 февраля 2014 г., Москва . ... 30 января - 4 февраля 2017 г., Москва . ... О школе . ... Четвертая школа-конференция "Алгебры Ли, алгебраические группы и теория инвариантов" проходила с 27 января по 1 февраля 2014 года на механико-математическом факультете МГУ им. М.В.Ломоносова и в Независимом Московском университете. ...
... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-2.pdf -- 1261.4 Кб -- 13.09.2014 Похожие документы
... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...
[
Текст
]
Ссылки http://np-chair.sinp.msu.ru/download/epja100510-offprints.pdf -- 426.2 Кб -- 18.03.2015 Похожие документы
Open Conference Systems . Conference Help . ... All Authors Title Abstract Index terms Full Text . ... Call for Papers (March 1, 2016 - June 1, 2016) . ... By Conference . ... It is incumbent on the authors to obtain appropriate approval to present their work to this international forum. 35-word Abstract : Your abstract should be a brief summary of your paper topic. If your paper is accepted, your 35-word abstract will be included in the Conference Program and the Technical Digest on CD-ROM . ...
... Development of a computer-based information system for Russian folklore studies . Computer systems SKAZKA and SKAZKA-2 are developing by A.V. Rafaeva. The aim of this work is to make program tools for structural analysis of folktale plots and motives. ... 112 – 113; Rafaeva A.V. Analiz rodstvennykh otnoshenij s pomosh’ju sistemy SKAZKA (Analysis of Relate Terms with the Help of SKAZKA Program) // Problemy kompjuternoj lingvistiki: Sbornik nauchnykh trudov, 1. ...
... О кафедре . ... Научная работа . ... Главная Научная работа Математические модели взаимодействия элементарных и структурированных объектов . ... Ведущий научный сотрудник Эльтеков В.А. В разное время в состав группы входили: Н.Н.Шапошников, А.В.Овсянкин, В.Б.Шикалов, Н.Г.Васичкина (кафедра математики), Л.П.Развина, О.В.Попова, Н.Н.Негребецкая (кафедра физической электроники), В.Н.Самойлов, Н.Г.Ананьева (кафедра общей физики). ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...
... О кафедре . ... КРИВОНОЖКО Владимир Егорович (11.06.1948, г. Москва) д.физ.-мат.н., профессор МФТИ, зав. кафедры АСУ МИСИС. ... Krivonozhko V. E., F rsund F. R. Lychev A. V. Terminal units in DEA: Definition and Determination // University of Oslo. ... F rsund F. R., Krivonozhko V. E., Lychev A. V. Hidden Effects in DEA Models //Differential Equations. ... Krivonozhko V. E., F rsund F. R., Lychev A. V. Some Ulterior Effects in the DEA models // Abstracts of the INFORMS Annual Meeting. ...