... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

Design of Micrometeoroid/Orbital Debris Impact Shield and Development of Failure Risk Assessment System for Orbital Spacecraft N.G. Chechenin Skobeltsyn Institute of Nuclear Physics Lomonosov Moscow State University Space Debris Growth http://www.nasa.gov/pdf/582393main_OCT-Orbital_ Debris _TAGGED.pdf January 19, 2015 China-Russia Joint Space Science Project Proposals Workshop 2 Space ... Crater formation January 19, 2015 Craters on metal surface from meteoroid particle. ...

Еще в разделе: (Показать все результаты (>125) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/Seminars_Pdf-filesPresentations/Chechenin_Presentation_14-01-16.pdf
• http://danp.sinp.msu.ru/21proceed/589.pdf

... id #1550 . Journal of Immune Based Therapies and Vaccines [J Immun Based Therap Vaccin] . Common information . ... no information] . ... 1476-8518 . ... since 2003-01-01 till today . ... FREE electronic journal! ... http://www.jibtherapies.com/home/ . ... today . ...

Еще в разделе: (Показать все результаты (>53) - journals.genebee.msu.ru/ )

. (just an example illustrating how to create a new topic based on a specific template topic. TemplateTopics has more) . -- WikiGuest - 10 Apr 2016 . This topic: System > ExampleTopicTemplate . Topic revision: 29 Nov 2009, ProjectContributor . Copyright by the contributing authors. All material on this site is the property of the contributing authors. Ideas, requests, problems regarding Foswiki? Send feedback

Еще в разделе: (Показать все результаты (>2208) - wiki.cs.msu.ru/ )

• (backlinks in System Web) WebTopicCreator < System < Foswiki
• (backlinks in all Webs) WebTopicCreator < System < Foswiki
• UserDocumentationCategory < System < Foswiki

... This applet generates an observing list based on an observer's location and time. ... To use this program, enter in your location, and the local times at which you wish to begin and end observing. The date you enter should correspond to the calendar day at the time at which you begin observing. For example, if you wish to observe from 9:37 PM October 23, 2007 until 3:21 AM October 24, 2007, you would enter 21:37 for the starting time, 03:21 for the finish time, and 10/23/2007 for the date. ...

Еще в разделе: (Показать все результаты (>235) - observ.pereplet.ru/ )

• MASTER GLOBAL ROBOTIC TELESCOPES NET

... Grant of the Russian Foundation for Basic Research (RFBR) No. 16-32-00882 for 2016-2017 "The creation of fluorescent biomarkers on the basis of nanodiamonds and optimization of their properties for targeted delivery of drugs and monitoring their excretion" (headed by K. A. Laptinskiy) . ... Grant of the Russian Foundation for Basic Research (RFBR) No. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>46) - rswater.phys.msu.ru/ )

... Master's Programme . ... On-line консультант . ... Master s Programme Enterprise Resource Management System has been developed basing on methodology from SAP, Oracle, Microsoft Companies, as well as the experience of national higher school and international universities. The key objective (mission) of the Programme is to educate professionals in the organization and implementation of projects aimed at deployment and maintenance of ERP systems at domestic enterprises. ...

Еще в разделе: (Показать все результаты (>14) - erp.cmc.msu.ru/ )

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>13) - iconolat13.phys.msu.ru/ )

• Program topics
• Symposia

Research Interests . Main current projects: . The Continuous Wavelet Transform based on the solution of Partial Differential Equations and its applications . ... Mean-field description of Kinetic Aggregate's Growth and Disease Spead including Anomalous Diffusion. ... It is based on the reducing of this integral transform to the exact analytical representation as the series of the Bessel and Struve functions multiplied by the wavelet coefficients of the input function. ...

Еще в разделе: (Показать все результаты (>97) - chaos.phys.msu.ru/ )

• Publications
• Science

Gamma-rays above 10 TeV Dieter Horns ґ University Hamburg RXJ1713-3946 [HESS Coll. ... The indirect path to the accelerator sky Dieter Horns ґ University Hamburg Is it a good deal? [astro-ph/0607109] Unveiling Cosmic Ray accelerators: Interstellar medium ( B-field + gas + photons) Accelerated Nuclei Meson production via inelastic scattering Gamma-rays , Neutrinos Cosmic rays Neutral particles (photons neutrinos) retain directional information: Accelerator sky Charged particles ( ...

Еще в разделе: (Показать все результаты (>8) - tunka.sinp.msu.ru/ )

• http://tunka.sinp.msu.ru/en/presentation/Khrenov.pdf

... Denis G. Gusev . ... M.S., Physics, Moscow State University, 2004, with honor . Second- and third-harmonic generation in coupled microcavities based on all-silicon photonic crystals", PDF . ... Dr. T.V. Dolgova . ... Dr. A.A. Fedyanin . ... D. G. Gusev , I. V. Soboleva, M. G. Martemyanov, T. V. Dolgova, A. A. Fedyanin, O. A. Aktsipetrov, "Enhanced second-harmonic generation in coupled microcavities based on all-silicon photonic crystals", Phys. Rev. B 68 , 233303 (2003). ... 5, 677 (2004). ...

Еще в разделе: (Показать все результаты (>44) - shg.phys.msu.ru/ )

• Intro

... Home Our Team Staff Lora S. Nikolaeva . ... Kalinin, USSR; graduated from Lomonosov Moscow State University, Mechanics and Mathematics Department in 1961. Work at Lomonosov Moscow State University, Chemistry Department from 1967. ... Joint investigstions with Department of Chemistry of Tver State University and Biology Department of Lomonosov Moscow State University have been made. ... Colloquium on 24.12.12 20 Dec 2012 . ... Department of Chemistry . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• TernAPI program Laboratory of Chemical Thermodynamics
• PhDi Laboratory of Chemical Thermodynamics

Государственное учебно-научное учреждение Московского государственного университета имени М.В.Ломоносова . ... Информация . ... История медицинского образования в МГУ . ... Аспирантура . ... Учебные планы . ... Введение в доказательную медицину (3 часа) . ... Источники информации в доказательной медицине(3 часа) . ... Клинические исследования как основа доказательной медицины (3 часа) . ... Факультет фундаментальной медицины Московского государственного университета им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>45) - fbm.msu.ru/ )

The Early Music Theatre >> Repertoire >> Poorhero Miss-the-target . ... Catherine II wrote librettos for five operas: "Hero Boleslavich of Novgorod" by Fomin, "Poorhero Miss-the-Target" by Martin y Soler, "Early Years of Oleg's Reign" by Sarti, Canobbio and Pashkevich. The first night of the opera "Poorhero Miss-the-Target" was on January 20, 1789 at the Hermitage Theatre. ... Martin y Soler's music was elegant and natural, it helped to hide a lot of drawbacks of contemporary opera librettos. ...

Еще в разделе: (Показать все результаты (>7) - www.tsm-msu.ru/ )

• The Early Music Theatre -- Repertoire
• Fairy Queen
• The Early Music Theatre -- Carmina Profanae

NEW ECONOMIC SCHOOL .. BSP/2007/094 R 2007 " " .. ... On The Dynamics of People's Unions / Working Paper # BSP/2007/094 R. - Moscow, New Economic School, 2007. - 19 p. (Rus.) ... Key words: public economics, allocation theory, size of nations ISBN © .. ... x[0,1] - (FOC) FOC: (W1 (x) + W2 (1 - x)) = 0, x (1) - (SOC) SOC: 2 (W1 (x) + W2 (1 - x)) 0. x2 (2) , (1) (2), .. ... Grossman & Mendoza, 2001, 2004) , , , : , . ... On the Number and Size of Nations", Quarterly Journal of Economics Vol. ...

Еще в разделе: (Показать все результаты (>13) - belyakov.imec.msu.ru/ )

• http://belyakov.imec.msu.ru/papers/SPbGTU2003.pdf
• http://belyakov.imec.msu.ru/papers/ENOC2008.pdf

Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...

157. Ульяна Сергеевна Баймуратова / МГУ имени М.В.Ломоносова

158. "Applied r filtration manager, phd, belgium" - вакансия в разделе "Работа для

159. http://oc.cs.msu.ru/eroven/NEW%20Rovenskaya%20IIASA%20conference%20presentation.pdf

160. http://library.biophys.msu.ru/PDF/3336.pdf