... Numerical Analysis of Finite-Amplitude Wide Acoustic Beams in Two-Phase Marine Sediments . ... Numerical investigation of nonlinear three-dimensional acoustic wave propagation is finding increasing application in various problems where complicated combination   of nonlinear and diffraction processes makes an analytical study very difficult. In the present report the computational analysis is applied to study high-intensity acoustic beam propagation in two-phase water-filled marine sediments. ...

Еще в разделе: (Показать все результаты (>399) - acs366.phys.msu.su/ )

• Devices and Industrial Applications of Nonlinear Acoustics
• Nonlinear Acoustics of Fluids and Multi-Phase Media, Cavitation Phenomena
• Abstract (Invited)

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>32) - mailybaev.imec.msu.ru/ )

Magnetism Department MSU . ... Education . ... Process of education on magnetism division . ... Different courses on classical theory of magnetic phenomena and on actual problems of modern theory of magnetism are read on magnetism division. ... Students of magnetism division do practical work on the 8th term with more then 50 students from other divisions each year. ... Physics of semiconductors division . ... oblig. – alt. ... Alexander Shaligin, associate prof. assessment . ... oblig. 519, 505 . ...

Еще в разделе: (Показать все результаты (>35) - magn.phys.msu.ru/ )

• Information for PhD students

Announcement On November 2-3, 2005 Lomonosov Moscow State University will conduct jointly with the Academy of Cryptography of the Russian Federation the Fourth All- Russian Conference Mathematics and Security of Information Technologies [Cybersecurity?] and jointly with the Center of International Studies, Cambridge University , United Kingdom, Advanced Research Workshop Unconventional ... Sherstyuk V.P. - Security Council of the Russian Federation; 3. ... Organization Committee 1. ...

Еще в разделе: (Показать все результаты (>25) - suny.msu.ru/ )

• http://suny.msu.ru/ru/ProgramMaBIT05En.doc
• Center on Russia and the United States :: Summary of SUNY/MSU Center Activities
• Center on Russia and the United States :: Other Russian Programs

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

Описание вакансии: . Company: Bekaert NV, Zwevegem, Belgium . ... Reporting to/hierarchy: Corporate Technology Manager . Function details: This person will use his/her filtration expertise for the improvement of metal fiber based filter products and processes in close collaboration with the Product Market Managers and Technology Managers of the Business Units. ... He/she will take the necessary actions for the introduction of new applications for Bekaert liquid and gas filters. ...

Еще в разделе: (Показать все результаты (>109) - www.chemport.ru/ )

• "Аналитик-исследователь" - вакансия в разделе "Работа для химиков" @ChemPort.Ru
• "Postdoctoral research position" - вакансия в разделе "Работа для химиков"
• "Sbr process specialist for lg chem, korea" - вакансия в разделе "Работа для

... Chair of Computer Methods of Physics . Department of Physics, M.V. Lomonosov Moscow State University . Welcome to the website of Chair of Computer Methods in Physics! ... methods of analysis and interpretation of experiments (computing and measurements systems theory) . mathematical methods of image analysis and interpretation . methods of fuzzy and uncertain fuzzy . ... Department of Physics M.V. Lomonosov Moscow State University , Chair of Computer Methods of Physics , 2014 . ...

Еще в разделе: (Показать все результаты (>6) - cmp.phys.msu.ru/ )

• Добро пожаловать! | Кафедра математического моделирования и информатики
• User account | Chair of Computer Methods of Physics
• Contacts | Chair of Computer Methods of Physics

... MSU School of Public Administration XX anniversary . Kormilets A.A., Bogdanov S.V. School of Public Administration of Lomonosov Moscow State University: a look back on a 20-year long way . Administrative problems: theory and practice . ... Lukashov G.A. A Conceptual Model for National Strategic Management in a Branch of Economy (on the Example of the Russian Power Industry) . Malakhova T.A. Priorities of Investment Policy in the Development Industrial Sector of the Economy . ...

Еще в разделе: (Показать все результаты (>376) - ee-journal.spa.msu.ru/ )

The most up-to-date information related to atmos 3.0 are collected here due to constantly increasing interest to MASS/DIMM processing software... atmos 3.0 is still beta , so the latest version is 2.97.5 (there is also 2.98.x branch which absorbs new features) . ... M' line: . ... free seeing and its relative error . ... dimm seeing and its relative error (if dimm data are present, zeros otherwise) . ... dimm turbulence power and its relative error (if dimm data are present, zeros otherwise) . ...

Еще в разделе: (Показать все результаты (>25) - curl.sai.msu.ru/ )

... Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures is very young. We have grown up in the laboratory of laser spectroscopy of water media. ... Use of such powerful modern tools of solution of inverse problems and problems of optimization provides successful solution of a wide range of applied problems of diagnostics and analysis of water media. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>40) - rswater.phys.msu.ru/ )

• Group of laser spectroscopy of solutions of supramolecular compounds and

... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблемљ и для их преподавания. ...

Еще в разделе: (Показать все результаты (>5) - unesco.fgp.msu.ru/ )

• News from the UNESCO Chair on Global Problems Кафедра ЮНЕСКО по изучению
• Заведующий кафедрой Кафедра ЮНЕСКО по изучению глобальных проблем на факультете

Laboratory of Micro- and Nanofluidics . ... Prof. Dr. Olga I. Vinogradova . ... Research . ... Job and Diploma/PhD . ... PhD student, Junior Research Fellow . ... Salim R. Maduar studied chemistry at the M.V.Lomonosov Moscow State University. In 2010-2011 he in addition studied functional nanomaterials, and since 2011 studied bionanotechnology at the MSU Nanotechnology Education and Research Center . ... In 2011 he joined the group of Prof. Olga I. Vinogradova to work on his Diploma thesis. ...

Еще в разделе: (Показать все результаты (>60) - nanofluidics.phys.msu.ru/ )

• Tatiana V. Nizkaya
• Taras Y. Molotilin
• Olga I. Vinogradova

. To see a Russian version of this page click here . (Senior Researcher. Graduated from Moscow State University (MSU) in 1982, Ph.D. 1986, MSU) . A member of EAS and IAU. Fields of interest: hot massive stars, close binary systems: optical photometric and spectral observations, X-ray observations; ill-posed problems, X-ray astrophysics. My publications (ADS link) . Linux on CLEVO 8750 (old stuff) . Phones/addresses of my university mates graduated in 1982. E-mail: igor@sai.msu.ru .

Еще в разделе: (Показать все результаты (>28) - uranus.sai.msu.ru/ )

• Tatjana Khruzina
• Anatol Cherepashchuk
• Linux on CLEVO 8750

... The primary goal of KOMAROVIA - the first English language botanical periodical published in Russia is to bring to international audience the results of botanical researches carried out in Russia and other countries of the former USSR and, in the first turn, botanists of the Komarov Botanical Institute - leading Russian botanical institution. We intend to publish KOMAROVIA at least once per year. ... Synopsis of the genus Pugionium Gaertn. ... A new subspecies of Pseudosedum ferganense Boriss. ...

Еще в разделе: (Показать все результаты (>246) - herba.msu.ru/ )

• Algological Electronic Newsletter
• The employment of quantitative methods for the lake ecosystem research
• INTERNATIONAL SYMPOSIUM

... Dr. G. Koptsik . ... Aim of this project is to develop a tool to quantify the risks of excess inputs of heavy metals to agricultural and forest ecosystems. ... Geographically the accent will be put on agricultural and forest ecosystems of the Northern (Kola Peninsula) and Central (Upper Oka-river basin) parts of Russia. ... Koptsik G.N., Nalbandyan K.F. 2002. ... Koptsik, S., Koptsik, G., and Eruslankina, L. Heavy metals in subarctic forest ecosystems: soil pollution and impacts on plant diversity. ...

Еще в разделе: (Показать все результаты (>28) - eco.soil.msu.ru/ )

• Norwegian-Russian cooperation in the border area
• Koptsik G.N., et al. Soils of the National Park "Russian North".

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>172) - www.pereplet.ru/ )

THE LANGUAGE OF A. PLATONOV . ... Alexei Petrovich Tsvetkov . A dissertation submitted in partial fulfillment of the requirements for the degree of . Doctor of Philosophy (Slavic Languages and Literatures) in The University of Michigan 1983 . Doctoral Committee: . Professor Vitalij Shevoroshkin, Chairman Professor Assya Humesky Professor Roman Szporluk Professor Irwin Titunik . ... 1983 . ... Профессор Б.В.Шеворошкин, председатель . Профессор Ася Гумецкая . ...

Еще в разделе: (Показать все результаты (>15) - uni-persona.srcc.msu.ru/ )

... Ср Май 27 11:19:02 MSD 2009 . ... НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru /news/ + В Gauss Centre for Supercomputing запущена новая инсталляция суперкомпьютера IBM Blue Gene/P с пиковой производительностью 1 PFlop/s. http ://www.fz-juelich.de/portal/index.php?index=163 jahr= 2009 cmd=show mid=670 + Суперкомпьютер Ranger используется для моделирования слияния черных дыр. http ://www.tacc.utexas.edu/research/users/features/dynamic.php?m_b_c=matzner + ...

Еще в разделе: (Показать все результаты (>428) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #269 [11/08/2009]
• PARALLEL.RU - Новости, выпуск #282 [02/03/2010]
• PARALLEL.RU - Новости, выпуск #306 [20/04/2011]

... PE8_10 Production technology, process engineering PE8_11 Product design, ergonomics, man-machine interfaces PE8_12 Lightweight construction, textile technology PE8_13 Industrial bioengineering PE8_14 Industrial biofuel production PE9 Universe sciences : astro- physics / chemistry / biology ; solar system; stellar, galactic and extragalactic astronomy, planetary systems , cosmology; space science , instrumentation PE9_1 Solar and interplanetary ...

Еще в разделе: (Показать все результаты (>45) - ideas.msu.ru/ )

• http://ideas.msu.ru/news/19_10_2010/Results_country.pdf

... A This result can be applied to a wide variety of data sets, including electricity bills1, street addresses, lengths of rivers, physical and mathematical constants, and processes described by power laws. ... Based on the plausible4 assumption that people who make up figures tend to distribute5 their digits fairly uniformly, a simple comparison of first-digit frequency distribution from the data with the expected distribution according to Benford's law had to show up any anomalous results. ...

Еще в разделе: (Показать все результаты (>28) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/theses3.pdf
• http://www.eng.math.msu.su/download/Notice_2013.pdf
• http://www.eng.math.msu.su/download/Mathematical_language1.pdf