... CONDENSED MATTER L ocalized-to-Propagating Surface Plasmon Transitions in Gold Nanoslit Gratings1 M. I. Dobynde, M. R. Shcherbakov, T. V. Dolgova, and A . ... For the narrower slits, the transmittance spectra show features associated with pure PSP excitation. ... Values to the left are the slit width values. ... The propagation length spectr um for the grating with a slit width of 300 nm shows a maximum at 620 nm, which also exceeds the propagation length value along the non-perforated gold f ilm. ...

Еще в разделе: (Показать все результаты (>64) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/ol40_1571_2015.pdf
• http://nanolab.phys.msu.ru/sites/default/files/acsphotonics.pdf
• http://nanolab.phys.msu.ru/sites/default/files/ppur4z-prb78_193102_2008.pdf

... The latter should be taken into account and carefully modeled as a fluid-structure interaction (FSI) problem. A patient- specific FSI analysis is impossible because it predicts only estimated hemodynamic features which are based on assumptions regarding material properties. The objective of this study is to develop a new methodology that assimilates medical imaging data for quantitative hemodynamic data extraction. ...

Еще в разделе: (Показать все результаты (>10) - hit-conf.imec.msu.ru/ )

Quantum Chemistry in Studies of Elementary Stages of Enzymatic Catalysis Alexander Nemukhin Department of Chemistry M.V. Lomonosov Moscow State University Russian Federation N.M. Emanuel Institute of Biochemical Physics Russian Academy of Sciences The aim is to study mechanisms of chemical reactions in complex molecular environment by considering J. Phys. Chem. ... Chem., ... Modeling, 2005, 11, 503 Grigorenko B., Rogov A., Nemukhin A. // J. Phys. Chem. ...

Еще в разделе: (Показать все результаты (>9) - lcc.chem.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Briedis V. Pareto Structures A great Italian economist Vilfredo Pareto (1848 ­ 1923) in his unique economics and sociology studies [1, 2] continuously emphasised the systematic approach, reviewing the society development problems. ... Formal model of Pareto Structure First of all, provide a formal mathematical model adequately featuring the Pareto Structure. ... Indeed, I was primarily interested in the classical (harmonic structure) model at s = 1. ...

Еще в разделе: (Показать все результаты (>9) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf

... distant.msu.ru . ... Видеоархив МГУ . Список курсов . ... Курсы факультетов МГУ . Факультет мировой политики . ... Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1272 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1516 Курсы для школьников / Курсы от школ-партнеров / ГБОУ СОШ ?1159 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Школа ?2065 Курсы для школьников / Курсы от ... Открытые курсы МГУ . ...

Еще в разделе: (Показать все результаты (>2) - distant.msu.ru/ )

• Центр развития электронных образовательных ресурсов

XXVIII General Assembly of the IAU, SPS15 Beijing, August 31, 2012 . N.N. Samus, S.V. Antipin "Variable Stars and Data-Intensive Astronomy" . During the 26th IAU General Assembly in Prague, the IAU Division V (Commissions 27 and 42) considered the future of variable-star catalogues. ... To discuss these problems and to look for their solutions, the IAU Commission 27, on behalf of the IAU Division V, created an informal working group, chaired by the GCVS editor, Dr. Nikolai Samus. ...

Еще в разделе: (Показать все результаты (>77) - sai.msu.ru/ )

• General Catalogue of Variable Stars: Variability Types

... Новости . О МЛЦ МГУ . ... Заявки до 25 октября 2015г. Семинар МЛЦ и кафедры . 23.03.2016 . ... Главная Новости Семинар МЛЦ и кафедры . ... квантовому перепутыванию (quantum entanglement), нарушению соотношений Белла, лазерному охлаждению . ... From Einstein s intuition to quantum bits: a new quantum age? ... Based on that concept, a new field of research has emerged, quantum information, where one uses quantum bits, the so-called 'qubits'. ... 2016 Семинар кафедры ОФиВП и МЛЦ . ...

Еще в разделе: (Показать все результаты (>82) - ilc.phys.msu.ru/ )

• Publication
• Публикация
• Setup for high-resolution luminescence spectroscopy

Academic English Part 4 of 4 Sources: 1. ... Cambridge University Press Unit After · · 51 completing the tasks the students will: Learn about US system for higher education in science Learn some communicative strategies they might use when asking for help or information from colleagues · Learn to write a CV and participate in an interview · Revise their reading strategies · Revise their summarizing strategies Camb 1. 2. 3. 4. ridge English for Scientists, Unit 1, pp.6-7 all ...

Еще в разделе: (Показать все результаты (>19) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/last_year_theses_by_A_Rakitko.pdf
• http://www.eng.math.msu.su/download/Model_rendering_scheme_and_connectives.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• ConClus

... 8 February , 2014 SAI seminar (Ryde et al 2010) 5 Thermal emission from GRB jet progenitor observer photon jet Photosphere (=1) · · · · Photons are not produced at the photosphere We have to calculate radiative transfer We need to know where the photons are produced We construct the expression for effective optical depth in relativistic flow considering random walk process in relativistic flow SAI seminar 6 8 ... 8 February, 2014 SAI seminar 28 ...

Еще в разделе: (Показать все результаты (>20) - master.sai.msu.ru/ )

• SAI Space Monitoring Laboratory
• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists

Contemporary media environment is formed by dense concentration and interaction of cultures, languages, channels and modalities of communication. ... Across this new terrain, rich, exciting and risky, the new generation of media practitioners, teachers, researchers and public intellectuals is expected to navigate competently and creatively. ... Nor can the idea of intercultural communication be limited (as it was тАУ only recently) to relatively formal contact between established national cultures. ...

Еще в разделе: (Показать все результаты (>17) - discours.philol.msu.ru/ )

• Tatiana Venediktova
• Summer School Archives
• Summer School 2016

... 9, 139 ­ 140 (2009) / DOI 10.1002/pamm.200910044 New cases of integrability in dynamics of a rigid body with the cone form of its shape interacting with a medium Maxim V. Shamolin 1 1 Institute Of Mechanics, Lomonosov Moscow State University, Michurinskii pr., ... We use the properties of body's motion in a medium under conditions of the jet flow past this body. ... The new families of phase portraits of variable dissipation systems are obtained, their absolute or relative roughness is demonstrated....

Еще в разделе: (Показать все результаты (>35) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-134-1.pdf
• http://shamolin2.imec.msu.ru/art-168-1.pdf
• http://shamolin2.imec.msu.ru/art-160-1.pdf

Adsorption of Humic Substances onto Kaolin Clay Related to Their Structural Features Gerd U. Balcke,* Natalia A. Kulikova, Sebastian Hesse, Frank-Dieter Kopinke, Irina V. Perminova, and Fritz H. Frimmel ABSTRACT Eleven well characterized humic substances (HSs) were adsorbed from aqueous solution onto a Na-kaolin clay. ... ADSORPTION OF HUMIC SUBSTANCES ONTO KAOLIN CLAY 1809 Fig. ... Weight averaged molecular weights (MWs) of humic substance (HS) before and after adsorption onto Na-kaolin clay. ...

Еще в разделе: (Показать все результаты (>86) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2009/2009-philippova-biological.pdf
• http://www.mgumus.chem.msu.ru/publication/2009/2009-gaspar-combined.pdf
• http://www.mgumus.chem.msu.ru/publication/2003/perminova-molecular-03.pdf

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Source URL: http://ani.cs.msu.su/en/node . ... 8] http://ani.cmc.msu.ru/files/Расписание лекций консультаций 2015 (2).xls . ... 12] http://ani.cmc.msu.ru/files/Защ.дипл.работ 2015 (бПМиИ).doc . 13] http://ani.cmc.msu.ru/files/Защ.дипл.работ 2015 (спец.).doc . 14] http://ani.cmc.msu.ru/files/Гос.экз. 2015 (бПМиИ).doc . 15] http://ani.cmc.msu.ru/files/Гос.экз. 2015 (спец.).doc . ...

Еще в разделе: (Показать все результаты (>6) - ani.cs.msu.su/ )

... Basic statement: "Mathematics is much clever, than Mathematician" It means, that after the scientist or engineer developed new mathematical model and designed corresponding equations, the solution to these equations produces new information unpredictable for the author! ... This vibration excites the shear wave in tissue 2 sx 2 - (ct + ) s x = Fx 2 t t Studies in Fluid Dynamics of water jet are connected with two main problems: 1. Flows in contracting nozzle forming high-speed jet. ...

Еще в разделе: (Показать все результаты (>43) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/gusev_files/diff2011.pdf
• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/ursi2.pdf
• http://acoustics.phys.msu.su/teachers/gordienko_files/localization_eng.pdf

... The Symposium's three breakout sessions focused on risks from different perspectives: enterprise use, resource constrained environments, and combating malicious use. ... Specifically, a DNS collaborative response, awareness, technical training, and future DNS security, stability, and resiliency collaboration should take precedence within the issues selected for further study and implementation. ... Breakout Session Overview.. ... 30 Appendix F: Combating Malicious Use Breakout Session Guide Book .. ...

Еще в разделе: (Показать все результаты (>20) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2009/malisevic.doc
• http://www.iisi.msu.ru/UserFiles/File/bayern2014/Forum_1.pdf

THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...

Еще в разделе: (Показать все результаты (>3) - www.law.msu.ru/ )

... Surveys 57:4 (2002), to appear Exactly solvable periodic Darboux q -chains Ivan A. Dynnikov and Sergey V. Smirnov Let L1 , L2 , . be selfadjoint differential operators acting on R. They form a Darboux chain if they satisfy the relation Lj = Aj A+ - j = A+ 1 Aj -1 , (1) j j- where Aj = -d/dx + fj (x) are first order differential operators. ... The operator L + appears to be the harmonic oscillator in the particular case r = 1. ... The operators of a periodic Darboux chain are finite-gap if = 0. ...

Еще в разделе: (Показать все результаты (>126) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/~asmish/Lichnaja-2010/Version2010-11-20/Trudy/Publications/2011/Mishchenko-Ribeiro-1102.5698v1.pdf

SOLID SOLUTIONS IN THE REALM OF MINERALS V. S. URUSOV A majority of minerals is not pure substances, but complex mixtures - solid solutions. ... унй нДдйЦ нЗЦкСхЦ кДлнЗйкх? 54 ї м ЫТУ, З.л., 1996 , , -, , -, . лйкйлйЗлдав йЕкДбйЗДнЦгъзхв ЬмкзДг, <11, 1996 ( ) . ... Fe (Mn, Co, Ni) ZnS Zn FeS. ... мкмлйЗ З.л. нЗЦкСхЦ кДлнЗйкх З еакЦ еазЦкДгйЗ 55 . ... 4]. дДд Згаьын нЦеиЦкДнмкД а СДЗгЦзаЦ зД ийЗЦСЦзаЦ нЗЦкСхп кДлнЗйкйЗ? , , (), , , 1 , 0њ. / () 58 лйкйлйЗлдав йЕкДбйЗДнЦгъзхв ЬмкзДг, <11, 1996 . ...

Еще в разделе: (Показать все результаты (>22) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/courses/genet/
• http://cryst.geol.msu.ru/literature/lit_aks.php

Pod-Moscowny . Moscow-Regional) . Branch . ... Moscow State University . Page in Russian . Moscow-Regional Branch of M.V.Lomonosov Moscow State University was founded in 1996 in Chernogolovka , town for science and education, placed in 40 km to the North-East from Moscow-city border. Chernogolovka today is considered to be one of the most important Russian scientific and educational centers in physics and chemistry . ... Branch of Moscow State University, . ... Russian Federation . ...

Еще в разделе: (Показать все результаты (>11) - www.issp.ac.ru/ )