... Geography of World Economy . ... This led to the need to study the spatial organization of the world economy, geopolitics, the geography of international economic relations, regional integration of states and other relevant topics. ... Elena N. Samburova, PhD (Geography): geographical Sinology; the geography of international economic relations; position of Russia in the world economy; . ... Introduction into the Geography of World Economy: International Division of Labor (in Russian) . ...

Еще в разделе: (Показать все результаты (>107) - eng.geogr.msu.ru/ )

• Undergraduate study
• International programme in natural resourse management and law
• Postgraduate study

You are here: Iono Group / SAMNET / Magnetometers database . More information about each magnetometer is available by clicking on the station link. ... IMAGE . Alta, Norway . ... Andenes, Norway . ... SAMNET . ... BGS station, but archived at 1s resolution by SAMNET . ... Hankasalmi, Finland . ... IMAGE station, but archived at 1s resolution by SAMNET . ... 1s resolution data is available from the SAMNET data archive . ... This list can be filtered to show just SAMNET magnetometers . ...

Еще в разделе: (Показать все результаты (>181) - www.kosmofizika.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Co-Chairman of the Forum ґ Deputy Secretary of the Security Council of the Russian Federation , Sergey M. BURAVLEV Co-Chairman of the Forum ґ Adviser of the Security Council of Russian Federation , Director of Lomonosov Moscow State University Institute of Information Security Issues, Vladislav P. SHERSTYUK Co-Chairman of the Forum ґ Special Representative of the President of the Russian Official languages: Russian, English. ...

Еще в разделе: (Показать все результаты (>15) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2009/twomey.doc
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/global_dns.pdf

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

Еще в разделе: (Показать все результаты (>3) - saistud.sai.msu.ru/ )

... Department of Mathematics, . Faculty of Physics, MSU . ... Differential equations . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Abstract differential equations with applications in mathematical physics . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Methods of finite differences in mathematical physics . ... Inverse problems in mathematical physics . ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>8) - math.phys.msu.ru/ )

... Для их эффективного использования не достаточно широко распространенных языков высокого уровня, необходимы языки программирования, позволяющие использовать все предоставляемые производителем ресурсы. ... VHDL (Very high speed integrated circuits Hardware Description Language) - язык описания аппаратуры высокоскоростных интегральных схем. ... Verilog - это язык описания аппаратуры, используемый для описания и моделирования электронных систем. ... Особенности языков описания архитектуры Verilog и VHDL...

Еще в разделе: (Показать все результаты (>14) - fpga.parallel.ru/ )

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>5) - www.eng.geogr.msu.ru/ )

• Postgraduate study

Страница поддержки курса "Архитектура ЭВМ и язык ассемблера" для 1 потока . ... Ассемблер nasm . ... Программа курса . ... Компьютерные системы: архитектура и программирование. 1 издание . ... Итоги коллоквиума ?1 . ... Коллоквиум ?1 . ... Итоги экзамена и всего курса . ... Результаты коллоквиума ?1 . ... Older posts . Posted on 05.04.2016 by vartan . ... 5) Записать на языке ассемблера выражение с побочными эффектами, заданное на языке Си . ... Архитектура ЭВМ и язык ассемблера . ...

Еще в разделе: (Показать все результаты (>24) - asmcourse.cs.msu.ru/ )

• vartan | Архитектура ЭВМ и язык ассемблера

... Кафедры . ... Практика . Производственная практика 2015 . ... IS PLEASED TO WELCOME INTERNATIONAL STUDENTS TO . ... International students enjoy both a regular curriculum and an in-depth study of the Russian Language, Russian Culture and History of Russia. ... a certified Russian translation of  both the original of Secondary School Certificate (or equivalent) and its attachment. ... a certified copy of ID/passport (the original of ID/passport is to be produced on application) . ...

151. MASTER GLOBAL ROBOTIC TELESCOPES NET

152. http://www.protein.bio.msu.ru/~akula/Kulaichev%20Addition.pdf

153. http://ccoe.msu.ru/sites/default/files/presentations/MSU-Lecture-CUDA-Intro-2012.pdf

154. Кафедра математических и компьютерных методов анализа

155. http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download