... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

... December 27, 1999 . Solar Moss . Credit: TRACE Project , NASA . ... The false-color TRACE image above was recorded in extreme ultraviolet light on October 18. It shows the solar moss associated with hot magnetic plasma loops arching above one of the Sun's active regions . ... Solar moss isn't found growing only on the Sun's north side, but as a rule seems to lie above the photosphere or visible surface, in the transition region of the solar atmosphere. ... About APOD > . ...

Еще в разделе: (Показать все результаты (>65) - www.arcetri.astro.it/ )

• APOD: April 9, 1999 - WR 104: Pinwheel Star
• APOD: 2000 July 20 - AR9077: Solar Magnetic Arcade
• APOD: April 30, 1999 - Solar Shock Wave

... Scientific goals . Cosmic rays of extremely high energy . ... Gamma-bursts . Magnetospheric particles and radiation conditions . ... The Earth?s atmosphere is ?a target? for different types of space radiation. ... In the atmosphere high energy particles produce cascades of the secondary particles ? ... Gamma-bursts also produce their ?response? in the atmosphere in the form of Сherenkov radiation. ... Studies of the described above phenomena is the main goal of the ?Lomonosov? satellite. ...

Еще в разделе: (Показать все результаты (>47) - lomonosov.sinp.msu.ru/ )

• Magnetospheric particles and radiation conditions | Университетский спутник
• Lost Password | Университетский спутник "Ломоносов"
• Scientific equipment | Университетский спутник "Ломоносов"

... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>12) - hcs.cmc.msu.ru/ )

• Master program "Enterprise Information Systems" | Магистерское и послевузовское
• Master Education | Магистерское и послевузовское образование Entrance

About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...

Еще в разделе: (Показать все результаты (>7) - textbook.sinp.msu.ru/ )

... Описание вакансии: . The Famous FMCG Company (Top-3) looks for Standards Office Manager in R Department . ... Create and register R and Regulatory documentation . ... Manage update of documentation in valid forms. Daily tracking of documentation validity and make changes in proper time to ensure the correct and on time activity of commercial production. ... Fluent English and excellent computer skills, skills to work with the databases . High skills to work with people; teamwork skills . ...

Еще в разделе: (Показать все результаты (>101) - www.chemport.ru/ )

• "R@d manager" - вакансия в разделе "Работа для химиков" @ChemPort.Ru
• "Head of chemistry" - вакансия в разделе "Работа для химиков" @ChemPort.Ru

Вход в личный кабинет . ... Ярмарка вакансий и стажировок для студентов и выпускников вузов . Новости науки и техники События . ... Подписаться на новости . Вакансии . ... Компания: Nielsen company . The Nielsen Company is a market-leading information & media company with more than 41,000 employees in 100+ countries around the world. ... Please send your CV before June 9th marked in Subject line Summer Internship Program at: RussiaMoscow.HR@nielsen.com or info.russia@nielsen.com . ...

Еще в разделе: (Показать все результаты (>93) - www.physcareer.ru/ )

• HP Graduate Development Program 2010 / Вакансии / Physcareer.ru
• ЗАО КБ 'Ситибанк' ПРИГЛАШАЕТ НА РАБОТУ / Вакансии / Physcareer.ru
• Supply Network Operations- Supply Chain Manager-CS 00001567, компания Procter /

PHYSICAL REVIEW A, VOLUME 61, 052305 Analysis of radiatively stable entanglement in a system of two dipole-interacting three-level atoms I. V. Bargatin, B. A. Grishanin, and V. N. Zadkov International Laser Center and Department of Physics, M. V. Lomonosov Moscow State University, Moscow 119899, Russia Received 29 November 1999; published 7 April 2000 We explore the possibilities of creating radiatively stable entangled states of ... II only two transitions in the whole system. ...

Еще в разделе: (Показать все результаты (>78) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/PRA22309.pdf
• http://qilab.phys.msu.ru/papers/FortschrPhys-2000-en.pdf
• http://qilab.phys.msu.ru/papers/UFN-2001-44(6)-en.pdf

Cassa depositi e prestiti spa Long-Term Instruments for financing Infrastructure Franco Bassanini Chairman of Cassa Depositi e Prestiti Institute of the Russian Academy of Sciences September 22, 2010, Moscow Cassa depositi e prestiti spa Global capitalism and short-termism · The short-termism that characterized recent global capitalism had negative effects on the ...

Еще в разделе: (Показать все результаты (>22) - www.mse-msu.ru/ )

... Главная Факультет политологии Новости факультета Новость . ... На заседании Ученого совета факультета политологии МГУ состоялось торжественное вручение сертификата призеру международного конкурса эссе на английском языке ?Creating the Future We Want?. Декан факультета политологии профессор А. Ю. Шутов поздравил студента III курса Павла Воробьева и вручил ему от имени организаторов конкурса сертификат за глубокое понимание и раскрытие темы. ... Поступление на факультет политологии в 2016 году . ...

Еще в разделе: (Показать все результаты (>9) - polit.msu.ru/ )

• Новости факультета

Welcome to Fourmilab 's calendar converter! ... In the Julian calendar every fourth year is a leap year in which February has 29, not 28 days, but in the Gregorian, years divisible by 100 are not leap years unless they are also divisible by 400. ... The average length of a year is 365.2468 days compared to the actual solar tropical year (time from equinox to equinox) of 365.24219 days, so the calendar accumulates one day of error with respect to the solar year every 216 years. ... Excel serial day: . ...

Еще в разделе: (Показать все результаты (>13) - sbmg.geol.msu.ru/ )

• Ф-502

... ECOLOGICAL COOPERATION" . ... Brjanskaja oblast, Dubrovskij rajon, Seshcha (village), School . Brjanskaja oblast, Djat'kovskij rajon, Bytosh (village), School . ... Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Borodino (village), School . Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Yardenikha (village), School . ... Moscow, Children's Ecological Center of the National Park "Losinyj Ostrov" - the coordinator of ecological work of 18 Korolev-town's schools . Moscow, School #222 . ...

Еще в разделе: (Показать все результаты (>14) - www.ecocoop.ru/ )

• The Ecological Cooperation project is the first large scale childrenтАЩs
• For three and half years of activity the participants of Ecological Cooperation

... Surface plasmon-polaritons (SPPs) is a collective oscillation of light and electrons that propagate at the boundary between metal and dielectric. ... Ultrafast Laser Pulse Shaping by Plasmonic Crystals . In our group, controllable reshaping of a femtosecond laser pulse reflected from a plasmonic crystal based on 1D polymer grating with period of 750 nm covered by 50љnm silver film. ... Pulse duration ? ... nonlinear crystal. ... Ultrafast Polarization Pulse Shaping with Plasmonic Crystals . ...

Еще в разделе: (Показать все результаты (>209) - nanolab.phys.msu.ru/ )

• User account | Laboratory of Nanophotonics & Metamaterials
• Teaching | Laboratory of Nanophotonics & Metamaterials
• Contact khan | Laboratory of Nanophotonics & Metamaterials

... Положение об олимпиаде . ... Отборочный этап . ... от Оргкомитет олимпиады школьников "Ломоносов" - Четверг, 25 Февраль 2016, 12:10 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Среда, 3 Февраль 2016, 18:52 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Понедельник, 1 Февраль 2016, 17:12 . ... Оргкомитет олимпиады школьников ?Ломоносов? приглашает вас к сотрудничеству с целью организации и проведения заключительного этапа Олимпиады на вашей базе по различным профилям. ...

Еще в разделе: (Показать все результаты (>3) - olymp.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>21) - mouse.genebee.msu.ru/ )

Samsung Advanced Institute of Technology (http://www.sait.samsung.com/eng/about/e_index.jsp) SAIT is the Corporate Research Organization of Samsung Electronics Co., Ltd., ... Our aim is to foster a boundless exploration of sciences and technology, and SAIT offers an exciting and highly competitive research environment. SAIT is inviting outstanding individuals with leadership and creative thinking to our Recruiting Session. ... Contact Information: +82-31-280-8108, saitglobal@samsung.com ...

Еще в разделе: (Показать все результаты (>105) - www.msu.ru/ )

• http://www.msu.ru/news/official/2009/memorandum_eng.doc
• Faculty of Soil Science
• Nobel Prize Laureates from MSU

... Полная версия этой страницы: О макро-взаимодействиях, : 'не измышляя гипотез' . Студенческий форум Физфака МГУ > Наука физика > Проверка теорий на прочность . ... The appropriate name for this 'something' is Faraday scalar field ( FF ), in particular, GFF (gravitational) and EFF (electric). ... the regular mutual compensation of EFF macro and micro - objects, leads to certain neutral state of Faraday field - hereinafter NFF - with local manifestations of residual non-zero EFF . ...

Еще в разделе: (Показать все результаты (>1078) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Работа в Samsung
• Студенческий форум Физфака МГУ > Java
• Студенческий форум Физфака МГУ > Software Developer

... General astronomy . ... PHYSICAL CONSTANTS.. ... Nobel Laureates in Physics 1901-2002 . ... Lectures Astronomy-161 "Solar System" (Also it contains info about History of Astronomy) . ... The History of Science . ... College-Level Astronomy Courses - at American, Australian Universities and Colleges . ... Messier: . ... Science . ... Scientific American . ... JOURNAL OF COMPUTATIONAL PHYSICS . ... Scientific Journals . ... American Physical Society Journals: Physical Review, Review of Modern Physics ...

Еще в разделе: (Показать все результаты (>19) - astrometric.sai.msu.ru/ )

• Symbolic circuit processor
• Astronomy
• Europian Scientific Organizations

Psychology in Russia: State of the Art Volume 6, Issue 2, 2013 Russian Psychological Society Lomonosov Moscow State University Review of the book by Janna M. glozman "Developmental neuropsychology" Boydar Kaczmarek University of Economics and Innovation, Lublin, Poland (WSEI) Janna Glozman's book provides a comprehensive information on both Russian and Western developmental neuropsychology. ... Impaired development of cognitive functions in children is discussed in chapter 5. ...

Еще в разделе: (Показать все результаты (>169) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/science/psyrussia/2009/kashapov.pdf
• http://www.psy.msu.ru/science/psyrussia/2013/gladkova.pdf
• http://www.psy.msu.ru/science/psyrussia/2013-3/2013_3_49-59.pdf