... Настоящим выпуском антропологи МГУ объявляют о появлении нового издания 'Вестник Московского университета. Серия ХХIII. Антропология'. ... В продолжение традиций мы надеемся, что 2009 год станет годом обновления Музея антропологии Московского университета, который откроется в Старом здании на Моховой после ремонта и реконструкции. ... Балахонова Е.И. Африканские коллекции из Московского Публичного и Румянцевского музея в Музее антропологии МГУ. ... А.Л. Пурунджан (1947-2009) Открыть . ...

Еще в разделе: (Показать все результаты (>24) - www.anthropos.msu.ru/ )

NMW survey overview . Access image archive . ... The New Milky Way survey aims to detect bright (V<13.5) optical transients near the Galactic plane using an automated wide-field (8x6 deg.) system capable of surveying the whole Milky Way area visible from the observing site in one night. ... All images obtained during the transient search survey are available online (please use the image archive access form ). ... Images per field: . ... Images per night: . ... Milky Way imaging time: . ...

Еще в разделе: (Показать все результаты (>2) - scan.sai.msu.ru/ )

Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...

Еще в разделе: (Показать все результаты (>13) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/settingupapaysystem.doc

Lomonosov Moscow State University was established in 1755 . ... Lomonosov Moscow State University Diary . ... MSU Web Sites . ... Faculties . ... Study and Research . ... MSU, Faculty of Fundamental Physical-Chemical Engineering, Russia, 11999, Moscow, GSP-1, 1 Leninskiye Gory . ... Faculty of Fundamental Physical-Chemical Engineering (Physics and Chemistry Faculty) was established in 2006. Faculty consists of 2 departments: "Engineering Chemical Physics" and "Engineering Solid State Physics". ...

Еще в разделе: (Показать все результаты (>90) - www.msu.ru/ )

• Faculty of Soil Science
• Faculty of fundamental physical and chemical engineering
• The scheme of an arrangement of MSU buildings on Leninskiye Gory

... General Catalog of Variable Stars (GCVS database, Version 2012 Feb.) ... The cross-identification tables of the General Catalogue of Variable Stars (GCVS) contain all GCVS (including extragalactic variables from vol.V), NSV (New catalogue of Suspected Variable stars) and Supplement to the NSV stars as well as stars from the name-lists of variable stars nos. 67 - 80; it also makes it possible to find out identifications between the GCVS and the NSV catalogue. ... I-III) names are included. ...

Еще в разделе: (Показать все результаты (>147) - sai.msu.ru/ )

• European Astronomical Society(EAS): NEWS
• General Catalogue of Variable Stars: What's new.
• Astronomical and Astrophysical Transactions

. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the

Еще в разделе: (Показать все результаты (>9) - optics.sinp.msu.ru/ )

• ABOUT PARTICULARITIES OF INTENSITIES DISTRIBUTION IN CROSS-SECTION OF POWERFUL

Home . Data . ... Meteor-M тДЦ1 . ... Meteor-M тДЦ2 . ... Solar energetic particles . ... Solar flare database (RU) . ... Space Monitoring Data Center of SINP MSU (SMDC) collects the data of space experiments as well as scientific and applied models for studying the geomagnetic and radiation conditions in the near-EarthтАЩs space environment. ... Latest data from featured spacecrafts . Meteor-M #1 is alive! ... Space weather now . ... NOAA N3KL Solar Activity Monitor . ... Developed in 2007. ...

Еще в разделе: (Показать все результаты (>31) - smdc.sinp.msu.ru/ )

• COSRAD model - Space monitoring data center
• Space monitoring data center

Poligraphic complex (printing plant) - humanitarian aid from RRU to South Ossetia A.A. Tibilov State University The printing plant is intended to make a wide range of materials - textbooks, manuals, presentations, reports, informational and commercial printed matters. ... wide color range, surpassing that of offset printing; . ... simple operation and high reliability. [pic] Besides the printer, there is a digital color copier Duplo DPS850 (Japan) size A3, in the printing complex. ...

Еще в разделе: (Показать все результаты (>25) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/327.doc
• http://www.rsr-online.ru/doc/2011_10_31/4.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• ConClus

Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) SN detection, V.Kulikovskiy, ANTARES meeting in Amsterdam 22-09-2010 1/14 SN progenitor stars distribution A half of the possible sources of SN type II explosion are at 10kpc. Sensitivity decreases as the square of the distance to SN SN detection, V.Kulikovskiy, ANTARES meeting in Amsterdam 22-09-2010 2/14 Methods overview Single rate 1. exclude OMs affected by bio bursts 2. ...

Еще в разделе: (Показать все результаты (>19) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/INFN%20-%20NEMO.pdf
• http://antares.sinp.msu.ru/seminar/Kulikovskiy.pdf
• http://antares.sinp.msu.ru/docs/INFN%20-%20ANTARES.pdf

... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...

Еще в разделе: (Показать все результаты (>7) - phys.web.ru/ )

STUDY OF OIL POLLUTION IN MEXICO WITH RESISTIVITY SOUNDING V.Shevnin (IMP, Mexico, vshevnin@imp.mx), A. Ryjov (MSGPA, Moscow, Russia), E. Nakamura (IMP, Mexico), A. Sanchez (EcoExel, Mexico), V.Korolev (MSU, Moscow, Russia), A.Mousatov (IMP, Mexico). ... The high level of geologic and electromagnetic noise caused some problems in VES field application and data analysis. ... Oil pollution was found at two levels: near GWL and below in water saturation zone (on 4 - 10 m depth). ...

Еще в разделе: (Показать все результаты (>65) - geophys.geol.msu.ru/ )

• IPI_MTS - cross-section.
• Anis. Page2
• TES. C-effect

... Leading Research Associate (MSU) . ... Graduated from the Moscow State University, 1960 . PhD, Moscow State University, 1970 . Doctor of Sciences, Moscow State University, 1995 . ... Type of Research: experiment . Research Interests: . ... Graduated from the Moscow Institute of Chemical Technology, 1954 . PhD, Moscow Institute of Chemical Technology, 1958 . Doctor of Sciences, Moscow Institute of Chemical Technology, 1981 . ... Type of Research: experiment, theory . ...

Еще в разделе: (Показать все результаты (>3) - newcryst.phys.msu.ru/ )

• Search of novel crystalline materials

... We are interdisciplinary research team engaged with the studies on humic substances. ... 2006-2008 "Interaction of humic substances with biomembranes: quantitative estimation and mechanism", Russian Foundation for Basic Research (RFBR), #06-04-49017-a , (Summary in Russian). ... Full text (PDF-file, in Russian) . Abstract (PDF-file, in Russian) . ... Alkoxysilylated derivatives of humic substances: synthesis, structure, sorption properties ( Abstract, in Russian / Full text, in Russian ) . ...

Еще в разделе: (Показать все результаты (>107) - mgumus.chem.msu.ru/ )

• MGUMUS -- Current projects

... Physics of ferroelectrics, structural phase transitions, critical phenomena, physics of real crystals. ... Experimental study of the anomalous change of physical properties at ferroelectric phase transitions. ... Discovery of the new type of the change of the phase state of ferroelectric crystals - critical and overcritical behaviour near isostructural phase transition points. ... B.A.Strukov, "Global Hysteresis in Ferroelectrics with Incommensurate Phase", Phase Transitions, 15, 143-179 (1987). ...

Еще в разделе: (Показать все результаты (>24) - ferro.phys.msu.ru/ )

• Physics Fuculty of Moscow State University

THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...

Еще в разделе: (Показать все результаты (>3) - www.law.msu.ru/ )

Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>3) - seyranian.imec.msu.ru/ )

... О компании Dow . ... Ссылки на Dow или Компанию означают компанию Dow Chemical (The Dow Chemical Company) и ее консолидированные дочерние компании, если намеренно не указано иное. ... О компании Dow в России и СНГ . ... В настоящее время компания Dow проводит набор кандидатов для Программы развития коммерческих навыков (Commercial Development Program). ... Ability to learn and understand the critical technical, commercial and business features related to the products they will have to sell . ...

Еще в разделе: (Показать все результаты (>76) - www.physcareer.ru/ )

• Software Requirements Analyst / Вакансии / Physcareer.ru

Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...

Еще в разделе: (Показать все результаты (>4) - cellbiol.genebee.msu.ru/ )

Генетическая кристаллохимия . ... Исследуются причинно-следственные связи структурных преобразований в гомологических и морфотропных рядах минералов. ... На примере минеральных групп фосфатов, боратов, силикатов, ванадилфосфатов и борофосфатов прослеживаются пути формирования и преобразования кристаллических структур минералов в породах различных геохимических типов . ... Типоморфизм минералов. ... Якубович О.В., Урусов В.С. Генетическая кристаллохимия фосфатов гранитных пегматитов // Вестник МГУ. ...

Еще в разделе: (Показать все результаты (>26) - cryst.geol.msu.ru/ )