information . ... abstracts . ... in Russian . RLC'2004 Information letter . ... The Lomonosov Moscow State University . ... The Pushkin State Institute of Russian Language . The Vinogradov State Institute of Russian Language (Russian Academy of Sciences) . ... The Congress will be held on March 18-21, 2004 . ... Chairman of Organizing Committee of the Congress - . ... Russian as a means of the international and interethnic communication; . ... Language of abstracts - Russian. ...

Еще в разделе: (Показать все результаты (>343) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/main/people/kibrik-aa/cv.html

... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...

Еще в разделе: (Показать все результаты (>9) - bioinf.fbb.msu.ru/ )

• SDPlight
• Algorithm

... Main page News People . ASA . Master . Master net Homepage . ... MASTER . ... About Space Monitoring Laboratory, scientific directions, instruments, contacts . ... Latest news and news archive . ... http://observ.pereplet.ru/dokladi/lipunov_vesti_fm.mp3 . ... http://www.radiovesti.ru/articles/2013-02-15/fm/82327 . http://www.radiomayak.ru/news/show/id/46668 . ... http://radiovesti.ru/articles/2013-02-15/fm/82360 . http://mir24.tv/news/Science/ 6475008 . ... All news ...

Еще в разделе: (Показать все результаты (>308) - master.sai.msu.ru/ )

• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists

. РЕЙТИНГ СЛУХОВ . о проекте права пишите нам .

Еще в разделе: (Показать все результаты (>5) - www.niiss.ru/ )

... Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ­ Institute for Biomedical Problems, Russian Academy of Science invite you to take part in "VI Russian National School with International Participation on Muscle and Exercise Physiology "Systemic and cellular mechanisms in physiology of motor system". ... We invite scientists, post-grade students, residents and students to take part in School on systemic and cellular mechanisms in physiology of motor system. ...

Еще в разделе: (Показать все результаты (>7) - fbm.msu.ru/ )

... Malkhazova S.M. (ecology, medical geography), Doctor of Geography. ... Biology, Ecology with the fundamentals of biogeography , Biogeographic basis for nature conservation, Mathematical methods in biogeography , Methods of field studies, Diversity of organisms, Ecology of human, Biogeographical mapping , GIS in biogeography and ecology , Ecology of organisms, Biogeography of foreign countries, Biogeography of Russia, Bioindication and Biomonitoring, Geography of utilization of ...

Еще в разделе: (Показать все результаты (>60) - eng.geogr.msu.ru/ )

• Department of Cryolithology and Glaciology
• Department of Oceanology

Hybrid Molecular Mechanics : For Effective Crystal Field Method for Modeling Potential Energy Surfaces of Transition Metal Complexes M. B. DARHOVSKII/-2 M. G. RAZUMOV/ A. L. TCHOUGREEFF12 1 3 I. V. PLETNEV,2' 4 L. Y. Karpov Institute of Physical Chemistry , Moscow , Russia 2 Center for Computational Chemistry at the M. V. Keldysh Institute/or Applied Mathematics of RAS, Moscow , Russia 3N. S. Kurnakov Institute of General and Inorganic ... 2002 Wiley Periodicals, Inc. ...

Еще в разделе: (Показать все результаты (>35) - analyt.chem.msu.ru/ )

• Molecular Mechanics Calculations of beta-Diketonate, Aqua, And
• Study of amino- and pyridyl-containing zinc(II) and cadmium(II) complexes by
• The Molecular Mechanic Approach to Coordination Compounds: Force Field Based on

EurasiaNet, a comprehensive resource for news about the Central Asian and Caucasus regions of the former Soviet Union, is now posting articles in Russian. The Russian-language stories are translations of exclusive analysis articles that are posted every day on the website. ... Just go to EurasiaNet's homepage and type your email address into the subscriber box. As a subscriber, you will automatically receive weekly announcements on stories posted on EurasiaNet in both English and Russian. ...

Еще в разделе: (Показать все результаты (>157) - www.prof.msu.ru/ )

• 2004 FULBRIGHT AMERICAN STUDIES INSTITUTES
• PROFESSIONALS FOR COOPERATION ASSOCIATION
• Vladimir Iakimets

... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . ... Department seminar . ... Vladimir Andreev , Moscow State University, Russia . ... Vera Beloshapko , Moscow State University, Russia . Alexander Belov , Moscow State University, Russia . Inna Belukhina , Moscow State University, Russia . Igor Blatov , Povolzhsky State University of Telecommunications and Informatics, Russia . ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>7) - math.phys.msu.ru/ )

Publications . General Information . ... For physics faculty . ... For natural faculties . ... At this page the list of all publications of members of the department is represented. ... List of publications for 1998 . List of publications for 1999 . List of publications for 2000 . List of publications for 2001 . Note: The publications is given in English only that publicated in anglo-language journals. ... Amount of publications in recent years: . ...

Еще в разделе: (Показать все результаты (>26) - ferro.phys.msu.ru/ )

• Physics Department of Moscow State University
• Laboratory of Ferroelectricity

ARTICLES . Mirskij G.N. Islam: the History and the Present . ... Karelin V.A. A Problem of Internment of the Russian Prisoners of War of the First World War . ... QUESTIONS OF TEACHING OF HISTORY . ... Keywords: Islam, history , the present . ... In the article V.A.Karelin investigates on the basis of documents of the Russian archives the problem of internment of the Russian prisoners of war during the First World War. ... Keywords: Internment, Russian Prisoners of War, the First World War . ...

Еще в разделе: (Показать все результаты (>248) - hist.msu.ru/ )

• Notes on Boris Mironov's article "Who Paid for Industrialization? S.Witte's
• Department of Archaeology
• Department of the History of Russian Social Movements and Political Parties

... TWiki ? ... Adding, renaming and deleting webs are all web-based operations. ... There are two methods used to create a new web. ... All topics in the template web will be copied into your new web. ... You can create hierarchical webs via the Adding a New Web form above, by using a slash- or dot-separated path name which is based on an existing web name in the Name of new web: field. ... To create a subweb named Bar inside a web named Foo , use Foo/Bar or Foo.Bar as the new web name in the form...

Еще в разделе: (Показать все результаты (>32445) - dualopt1.cmm.msu.ru/ )

• InstalledPlugins - TWiki - TWiki - (printable)
• %TOPICTITLE% (33 vs. 34) - TWiki
• %TOPICTITLE% (28 vs. 29) - TWiki

... Сен 19 . Юрий (admin) Новости диссертации , юмор No Comments . ... Юрий (admin) Новости измерение , Лайкерт , математические методы , опросник , опросы , порядковые шкалы , психодиагностика , шкала No Comments . ... Юрий (admin) Новости книги , научно-популярная литература , ссылки , эксперименты No Comments . ... Юрий (admin) Новости организационная психология , оценка персонала , психодиагностика , психологические тесты , психологическое тестирование , тестирование No Comments . ...

Еще в разделе: (Показать все результаты (>4) - tukachev.flogiston.ru/ )

• Tag: Article feedback Tool

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>228) - observ.pereplet.ru/ )

• Обсерватория

... Учебные отделения и программы . ... Программы подготовки на факультете . ... Полезные ссылки . ... Все рекомендованные и прошедшие отбор статьи будут опубликованы в журнале "Moscow University Young Researchers Journal: Languages, Cultures and Area Studies" . ... Articles submitted to this journal should make original contributions to the field of study. ... All articles are review by the editor and an external expert, who is a young researcher with a PhD degree in the corresponding research area. ...

Еще в разделе: (Показать все результаты (>75) - ffl.msu.ru/ )

• Research

International Symposium Biological Motility: New facts and hypotheses ================================================= Pushchino , Moscow region, Russia May 12-14, 2014 Chairman of Organizing Committee Prof. Zoya Podlubnaya Institute of Theoretical and Phone (4967)739269 Experimental Biophysics RAS Fax (4967)330553 Pushchino , Moscow region E-mail: motility2014@iteb.ru 142290, Russia Preliminary information Dear colleagues, The ... Deadline for sending abstracts is 1 of March 2014. ...

Еще в разделе: (Показать все результаты (>2) - cytol.bio.msu.ru/ )

... Registration and Abstract submission are open for the International Conference on Physics Education ICPE 2014 , that will take place at the Sheraton Cordoba Hotel & Convention Center, C rdoba, Argentina, on August 18th to 22th, 2014. ... Keynote Speaker: Cedric Linder , Professor of Physics Education Research, Division of Physics Education Research, Department of Physics and Astronomy, Uppsala University, Sweden. ... Prof. Zulma Gangoso (Chair) . ... Prof. Zulma Gangoso (Argentina) . ...

Еще в разделе: (Показать все результаты (>33) - foroff.phys.msu.ru/ )

• Papers of our group

The Apache Software License, Version 1.1 * * Copyright (c) 2000 The Apache Software Foundation. ... The end-user documentation included with the redistribution, * if any, must include the following acknowledgment: * "This product includes software developed by the * Apache Software Foundation (http://www.apache.org/)." ... The names "Apache" and "Apache Software Foundation" must * not be used to endorse or promote products derived from this * software without prior written permission. ...

Еще в разделе: (Показать все результаты (>198) - oit.cmc.msu.ru/ )

• BCMath Arbitrary Precision Mathematics Functions
• yaz_itemorder
• Часть V - Назначение и состав системы стандартов POSIX

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

... Absorption probability and laser induced quantum coordinate displacement spectra are calculated. ... Figures 3--6 show typical spectra of absorption probability in comparison with the same ones for the electronically equal two-level atom and the spectra of x-coordinate displacement for the Gaussian pulse with r = 0.5 p5; electronic transition frequency w12 = 1015 s1; mass parameter m = 1.4 x 1O_23 g; vibronic frequency for the ground state w1 = 1013 1 and for the excited ... 2 0, Fig. ...

Еще в разделе: (Показать все результаты (>73) - qilab.phys.msu.ru/ )

• Quantum Information Lab, Int'l Laser Ctr. and Faculty of Physics, M.V.Lomonosov