... Радиальные скорости фотосферы были равны 17 км/с 12 декабря 1977 года и . 24 км/с в сентябре 1974 года. Публикации с ключевыми словами: персоналии . Публикации со словами: персоналии . ... К 125-й годовщине со дня рождения Артура Стэнли Эддингтона . Артуру Кларку 90 лет . 80 лет со дня рождения Альберта Петровича Гуляева . 100 лет со дня рождения Евгения Кирилловича ХАРАДЗЕ . ... Все публикации на ту же тему >> . Обсудить эту публикацию . ...
О кафедре . ... Динамические задачи теории упругости . Динамика пластин и оболочек . ... Методы теории упругости . ... Нелинейная теория упругости . ... Пластины и оболочки . ... Теория и расчет оболочек тонкостенных летательных аппаратов . ... Теория упругости структурно-неоднородных тел . ... Уравнения изгиба пластин классическая линейная теория. ... Колебания пластин. ... Oscillation of plates . ... МГУ им. М.В.Ломоносова, механико-математический факультет, кафедра теории упругости . ...
... PhDi . ... SOFTWARE PACKAGE FOR CALCULATIONS OF PHASE DIAGRAMS . elaborated and developed by laboratory scientists) . The software package contains a database of thermodynamic properties for about 200 systems and a software based on a so called convex hulls approach. ... binary systems in coordinates Temperature - Composition at fixed pressure and Pressure ? ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Laboratory of Chemical Thermodynamics . ...
Вход в личный кабинет . ... Ярмарка вакансий и стажировок для студентов и выпускников вузов . Новости науки и техники События . ... Подписаться на новости . Вакансии . ... Ярмарки вакансий и выставки . ... Trainee supports Sales/Marketing projects, works with Data Bases, responsible for analytics and financial documents . ... If you would like to apply for SALES/MARKETING DEPARTMENT TRAINEE position you may send your CV to resume@rb.com . ... Ярмарка вакансий "Формула карьеры" . ...
... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...
Summary Progress Report 2010 2014 UNESCO Chair on Global Problems and Emerging Social and Ethical Challenges for Large Cities and Their Population at the Faculty of Global Processes of the Lomonosov Moscow State University Period of activity: September 2010 June 2014 Title of the Chair : UNESCO Chair on Global Problems and Emerging Social and Ethical ... Visit of UNESCO Director-General Irina Bokova at Moscow State University September 9, 2011. ...
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-1.pdf -- 1926.1 Кб -- 13.09.2014 Похожие документы
Home People Activities Research Publications . Yurin's home page . ... Юрин Д.В. "Расчетно-параметрическое исследование флуктуаций сигнала обратного рассеяния при лазерном зондировании взволнованного моря " // Автореферат диссертации на соискание ученой степени кандидата физико-математических наук (специальность 01.04.03-радиофизика). ... Юрин Д.В. "Метод расчета статистических характеристик сигнала обратного рассеяния при лазерном зондировании взволнованного моря " // В кн. ...
... Processes of regionalization in Post-Soviet space: contradictions of Russia-Belarus Integration. Moscow, Institute of economy RAS, 2010. ... Eurasian Economic Integration. 2010, 1. 4. 10 years of EurAsEC: everything is just starting (in co-authorship with R. Grinberg)./ ... Scientific Reports of the Institute of Economics of RAS. ... Analytical Bulletin of the Centre for Problems of Globalization and Integration of Institute of economics of Russian Academy of Sciences", 2007, Issue 4 (12). ...
... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... DRIVER: Develpment of numerical modelling of noise generation processes in turbulent flows (jets, wakes, fans etc.) ... AREA: Radiophysics, Electronics and Acoustics, Mechanics . ... STRATEGY: Application of effective methods of large size matrix approximation and using parallel algorithm model for numerical schemes . ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...
FemtoScan 001 - FAQ . Russian version . ... How to build a histogram for a part of image . ... How to copy and print files seen in Quick View . Quick View Parameters and other options . About Macros . ... Choose the command Parameters in the menu View or in the popup menu, which appears after pressing the right button of the Mouse. ... All the images seen in Quick View . ... QuickView] - Legend view, seen on the images of Quick View , number of images ( Show All Images ) . ...
... Society . ... Viktor Titovich Trofimov , professor, Department Chairman at the Faculty of Geology, Vice President of the Lomonosov Moscow State University . ... Ksenia Vsevolodovna Avilova , Candidate of Biological Sciences, senior research associate of the Faculty of Biology at the MSU . Aleksandr Sergeevich Alekseev , Doctor of Geological Mineralogical Sciences, professor at the Faculty of Geology at the MSU . ... 2015 Moscow Society of Naturalists . ...
Механико-математический факультет Московского государственного университета имени М.В. Ломоносова . Кафедра теоретической механики и мехатроники . ... Кафедра теоретической механики была создана в 1933 году при образовании механико-математического факультета Московского государственного университета имени М.В. Ломоносова. ... динамика неголономных систем; . ... МГУ имени М.В.Ломоносова, механико-математический факультет, кафедра теоретической механики и мехатроники, телефон (495) 939-36-81 ...
... Очередное заседание научно-исследовательского семинара факультета 8 апреля 2016 года . ... Заседание Московского математического общества 5 апреля 2016 г. 2 апреля 2016 - 10:18 . ... Юбилей проф. Шешенина С.В. 28 марта 2016 - 13:43 . ... Заседание Московского математического общества 29 марта 2016 г. 24 марта 2016 - 14:23 . День открытых дверей механико-математического факультета 27 марта 2016 г. 24 марта 2016 - 13:03 . ... 2016 Механико-математический факультет МГУ им. М.В. Ломоносова . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Октябрь 15, 2015 // Комментарии к записи Прием студентов 2-го курса на кафедру ихтиологии отключены // Опубликовано в: Новости | Прием на кафедру ихтиологии студентов 2-го курса состоится . ... Октябрь 15, 2015 // Комментарии к записи День открытых дверей кафедры ихтиологии отключены // Опубликовано в: Новости | ... Ноябрь 11, 2014 // Комментарии к записи Прием студентов 2-го курса на кафедру ихтиологии отключены // Опубликовано в: Новости | ... Биологический факультет МГУ им. М.В. Ломоносова . ...
... 247th American Chemical Society National Meeting and Exposition "Chemistry and materials for energy" , March 16-20, Dallas, TX Talk: A.V. Nemukhin "QM/MM-based modeling of structure and spectra of fluorescent proteins" . ... IV International Symposium "Topical Problems of Biophotonics", July 21-27, Nizhny Novgorod Invited talk: M.G. Khrenova , A.V. Nemukhin, A.P. Savitsky "Molecular modeling of the Forster resonance energy transfer between fluorescent proteins" . ...
Title Should Be in Bold, 18-Point Type and Centered, Please Use Title Case Author name(s) [10-point type, centered, bolded] Author affiliation and full address (8-point type, centered, italicized) Author e-mail address: (8-point type, centered, italicized) Abstract: Indent left and right margins 0.5 in. (1.27 cm), justify the paragraph (on both right and left), and use the same font as in the body of the paper. ... 5] Author(s), "Title of paper," in Title of Proceedings, Name(s), ed(s)., ...
[
Текст
]
Ссылки http://iconolat13.phys.msu.ru/ICONO_LAT-2013/Guidelines_files/Meetings-Style-Guide.pdf -- 128.6 Кб -- 26.01.2013 Похожие документы
... B.V. Somov . head of the department . ... room 80 . ... senior research felow . ... research felow . ... research fellow . ... Our department performes the following most perspective studies: . Special analytical and numerical experimental investigations of the solar plasma involved in the magnetic reconnection process at the Sun. ... Head of the seminar: Prof. B.V. Somov. ... 27 September 2013 The Solar Physics Department was visited by journalists of the leading Russian TV channel "Vesti-1". ...