... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>7) - srd.sinp.msu.ru/ )

... Leading Research Associate (MSU) . ... Graduated from the Moscow State University, 1960 . PhD, Moscow State University, 1970 . Doctor of Sciences, Moscow State University, 1995 . ... Type of Research: experiment . Research Interests: . ... Graduated from the Moscow Institute of Chemical Technology, 1954 . PhD, Moscow Institute of Chemical Technology, 1958 . Doctor of Sciences, Moscow Institute of Chemical Technology, 1981 . ... Type of Research: experiment, theory . ...

Еще в разделе: (Показать все результаты (>4) - newcryst.phys.msu.ru/ )

... VAK Russian Federation . Keldysh institute of applied mathematics . ... Unitied Institute of Physics of the Earth named for O.Yu. Schmidt see also another site of this Institute . ... Moscow Meriya . Institute of Nutrition of the Russian Academy of Medical Sciences . MSU, Physics Department . ... Skobeltsyn Institute of Nuclear Physics of MSU , see also another site . P.N.Lebedev Physical Institute Russian Academy of Sciences . ... M.V. Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>29) - astrometric.sai.msu.ru/ )

• Specification
• Other Russian Universities and Institutes
• Family

... Carbamide . ... Moscowљ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics љwasљestablished by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• Our Partners Laboratory of Chemical Thermodynamics
• TernAPI program Laboratory of Chemical Thermodynamics

Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>3) - seyranian.imec.msu.ru/ )

A project of laser electron X-ray generator for scientific applications I.A. Artyukov, E.G. Bessonov, A.V. Vinogradov, M.V. Gorbunkov, Yu.Ya. ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... It allows viewing collision of electrons with laser photons as the classical Thomson scattering. ... A project of X-ray laser-electron generator [7]. ...

Еще в разделе: (Показать все результаты (>8) - miles.sinp.msu.ru/ )

• http://miles.sinp.msu.ru/files/LEXG_ICLIM_2004.pdf
• http://miles.sinp.msu.ru/files/Berlin06_Laser.pdf
• http://miles.sinp.msu.ru/files/LEXG_SPIE_05.pdf

. Название публикации . Mechanical properties of human soleus fibers after 7-day dry immersion. Effects of plantar support stimulation and high frequency electrical stimulation . Авторы . I.V. Ogneva, E.V. Ponomareva, E.G. Altaeva, N.M. Fokina, V.A. Kurushin, I.B. Kozlovskaya, B.S. Shenkman . Дата . 31.12.2009 23:00:00 . Название журнала . Acta Astronautica. Купить нет на складе . 2009 ФФМ МГУ, 2009

Еще в разделе: (Показать все результаты (>19) - fbm.msu.ru/ )

... Porokhov, N., Kalabukhov, A., Chukharkin, M., Maresov, A., Khrykin, D., Klenov, N., and Snigirev, O. The physical basis of the fabrication of the third generation of high-temperature superconducting wires on quartz substrates.љ ... DOI љ] . Порохов, Н., Калабухов, А., Чухаркин, М., Маресов, А., Хрыкин, Д., Кленов, Н., иљСнигирев, О. Физические основы технологии создания высокотемпературных сверхпроводящих проводов третьего поколения на кварцевых подложках.љ ... URL љ] . ...

Еще в разделе: (Показать все результаты (>28) - cryolab.phys.msu.ru/ )

• Alexander G. Maresov
• Oleg V. Snigirev
• Molecular single-electronics

... In 1964 at the Institute of Mechanics of Lomonosov Moscow State University the laboratory of physical-chemical gasdynamics had been set up under the supervision of Tirskiy G.A., which employed a team of three scientists - Tirskiy G.A., Gershbein E.A., Suslov O.N.; before they worked in the general hydromechanics division. ... V.N. Chelomey Medal of Astronautics Federation of Merit for the National Astronautics (2004, Kovalev V.L., Sakharov V.I., Tirskiy G.A.). ...

Еще в разделе: (Показать все результаты (>11) - lab106.imec.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Preferences can be configured by web or site-wide. ... In particular, TWiki provides two highly configurable, automated site monitoring tools, WebNotify , to email alerts when topics are edited, and WebStats , to generate detailed activity reports. ... You can use the topic in the Main web as a template. ... There is a workaround in case you can't run the script as user nobody : Run the utility twiki/bin/geturl in your cron job and specify the URL of the twiki/bin/statistics script as a parameter. ...

Еще в разделе: (Показать все результаты (>33942) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (30 vs. 34) - TWiki

05 Nov 2003 The Sun has continued its recent high levels of activity. At 1950 UT, 4 November 2003, a class X28 solar flare was released by the Sun. ... LASCO C2 Images of X28 Flare at 1950UT 04/11/2003 . ... SOHO (Solar and Heliospheric Observatory) is located between the Sun and the Earth and will, therefore, detect activity before it reaches the Earth. ... All this ongoing solar activity means that the Earth is destined to be bathed in more radiation - generating further auroral displays. ...

Еще в разделе: (Показать все результаты (>147) - www.kosmofizika.ru/ )

• CREATION AND DESTRUCTION OF THE SOLAR PROTON BELTS IN THE INNER MAGNETOSPHERE
• Frequently Seen Space/Astronomy Acronyms
• X-RAY, GAMMA-RAY EMISSION AND HIGH-ENERGY CHARGED PARTICLES IN NEAR-EARTH-

... The luminescence time dependence for two types of core/shell QDs (CdSe/CdS and CdTe/CdSe ) were investigated and were compared with behavior of naked ones (CdSe). ... Three different types of QDs were used in this work: simple core CdSe QDs, core/shell CdSe/CdS QDs and type II core/shell CdTe/CdSe heterostructures in charge carrier division regime (Fig.1). ... So core/shell nanocrystals demonstrate intermediate behavior between CdSe core-type QDs and CdTe/CdSe core/shell heterostructures. ...

Еще в разделе: (Показать все результаты (>50) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and
• The Laboratory of chemistry and physics of sensor and semiconductor materials |
• The Laboratory of chemistry and physics of sensor and semiconductor materials

... About Us . ... The English Language Department for Science Faculties . ... Courses delivered . ... Graduated from Moscow State University, Faculty of Foreign Languages and Area Studies . ... Graduated from Minsk State University of Linguistics, supplementary education under program for Translation in the Sphere of Professional Communication at Moscow State University, Faculty of Foreign Languages and Area Studies . ... Faculty of Foreign Languages and Area Studies Lomonosov Moscow State University: ...

Еще в разделе: (Показать все результаты (>176) - ffl.msu.ru/ )

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ...

Еще в разделе: (Показать все результаты (>5) - ani.cs.msu.su/ )

... MOIP (Moscow Society of Naturalists) is a unique social phenomenon in Russia?s life. ... Great scientists and thinkers such as academicians V.I. Vernadskiy and N.D. Zelinskiy presumed that MOIP acted in Moscow as the Academy of Sciences up to the Saint-Petersburg (Russian) Academy moving to the capital in the thirties of 20 th century. In the course of all these years, the Moscow Society of Naturalists united and coordinates almost all scientific potencies in the sphere of natural science. ...

Еще в разделе: (Показать все результаты (>7) - www.moip.msu.ru/ )

... Lectures, Questions & Answers . ... Moscow U) . ... I Solid St Chem Mechanochem) . ... Evgeny V. Antipov (Faculty of Chemistry, Moscow State University) New cathode materials for lithium batteries . ... Vladimir I. Feldman (Faculty of Chemistry, Moscow State University) Physics and chemistry of solvated electron . ... Galina A. Tsirlina (Faculty of Chemistry, Moscow State University) Diversity of electrochemistry: the specific problems of molecular models and their experimental verification . ...

Еще в разделе: (Показать все результаты (>26) - www.elch.chem.msu.ru/ )

• Edutorial

International Symposium Biological Motility: New facts and hypotheses ================================================= Pushchino , Moscow region, Russia May 12-14, 2014 Chairman of Organizing Committee Prof. Zoya Podlubnaya Institute of Theoretical and Phone (4967)739269 Experimental Biophysics RAS Fax (4967)330553 Pushchino , Moscow region E-mail: motility2014@iteb.ru 142290, Russia Preliminary information Dear colleagues, The ... Deadline for sending abstracts is 1 of March 2014. ...

Еще в разделе: (Показать все результаты (>3) - cytol.bio.msu.ru/ )

... Antal , T.K., Volgusheva , A.A., Kukarskih , G.P., Krendeleva , T.E., Rubin, A.B. Relationships between H 2 photoproduction and different electron transport pathways in sulfur-deprived Chlamydomonas reinhardtii (2009) International Journal of Hydrogen Energy, 34, pp. ... Antal , T.K., Volgusheva , A.A., Kukarskikh , G.P., Krendeleva , T.E., Tusov , V.B., Rubin, A.B. Examination of chlorophyll fluorescence in sulfur-deprived cells of Chlamydomonas reinhardtii (2006) Biofizika ., 51 (2), pp. ...

Еще в разделе: (Показать все результаты (>10) - biophys.msu.ru/ )

• One of the informative characteristics of the reverse electron transport in the
• Spontaneous chemiluminescence of seedling roots

... Interaction classes . Families of interaction class . Classes of protein-DNA interaction of SCOP families . ... CAP C-terminal domain-like . SSM . middle . ... high . ... KorB DNA-binding domain-like . ... Restriction endonuclease BglII . ... Middle domain of MutM-like DNA repair proteins . ... DNA-binding N-terminal domain of transcription activators . ... Recombinase DNA-binding domain . ... Viral DNA-binding domain . ... p53 DNA-binding domain-like . ... NPIDB team 2003 - 2016 . ...

Еще в разделе: (Показать все результаты (>5) - npidb.belozersky.msu.ru/ )