... Submit your article . ... Public Administration publishes scholarly articles on theory, methodology and practice of management, results of applied research projects in administration, studies of Russian and foreign administration experience, bibliographical reviews and information on conferences, round tables and workshops. ... The journal accepts polemic articles. ... All articles submitted for publication are first reviewed for compliance with the guidelines for article formatting and content. ...

Еще в разделе: (Показать все результаты (>10) - ee-journal.spa.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Briedis V. Pareto Structures A great Italian economist Vilfredo Pareto (1848 ґ 1923) in his unique economics and sociology studies [1, 2] continuously emphasised the systematic approach, reviewing the society development problems. ... Formal model of Pareto Structure First of all, provide a formal mathematical model adequately featuring the Pareto Structure. ... Indeed, I was primarily interested in the classical (harmonic structure) model at s = 1. ...

Еще в разделе: (Показать все результаты (>3) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf

Russia: Solid as a BRIC? CALL FOR PAPE RS Specia l Issue of Critica l Perspectives on Internatio nal Business Special Issue Edito rs: Snejina Mich ailo va, Professor o f International Business University of Au ckland Business School, New Zealand Sheila M. Pu ffer, Cherry Family Senio r Fellow of Internation al Business No rtheastern University, Boston, USA Daniel J. McCarthy, McKim-D'Amore Distinguished Professor o f Global Management and Inno vation ... Why this special issue? ...

Еще в разделе: (Показать все результаты (>31) - www.mgubs.ru/ )

• Высшая школа бизнеса МГУ им. Ломоносова

... The core of this technique is a partially metal covered dielectric bead optically trapped in a liquid with dye molecules. ... Control experiments, a plain and metal covered bead in water only, assure that the bead remains at a stable position in the trap at constant pump power. ... From 0ґ17 s the pump power is 0.13 mW. ... Although the SCS response varies based on the pump power it is important to realize that the force acting on this bead remains constant at a fixed power in the absence of dye. ...

Еще в разделе: (Показать все результаты (>26) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/thg_in_fishnet.pdf
• http://nanolab.phys.msu.ru/sites/default/files/prb82_193402_2010.pdf
• http://nanolab.phys.msu.ru/sites/default/files/jetplett101_787_2015.pdf

... CELL BIOPHYSICS Application of a Photosystem II Model for Analysis of Fluorescence Induction Curves in the 100 ns to 10 s Time Domain after Excitation with a Saturating Light Pulse N. E. Belyaevaa, V. Z. Pashchenkoa, G. Rengerb, G. Yu. ... In the case of weak measuring light, the steady-state level of fluorescence induction curve (Fig. ... The model of PSII predicted that, upon long (10 s) exposure to weak measuring light, the states with open RCs are being populated (Fig. 4, curves 3, 5 QA). ......

Еще в разделе: (Показать все результаты (>24) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3347.pdf

... The Lectures Contents: Lecture one: Contemporary Historical and Political Background Part One: The Historical Stages of the Arab Political Development Part Two: The Nature of the Arab Political Systems and the Arab Modern Wars Lecture Two: The Middle East Scenario of Crisis and Conflict Part One: The Israeli/Palestine Crisis Part Two: The Superpowers' Role in the Arab Affairs Lecture Three: The Arab Modern Regional Politics Part One: The Arab Politics towards its Unitarian Movements. ...

Еще в разделе: (Показать все результаты (>2) - polit.msu.ru/ )

... Студеникин Александр Иванович (20.03.1957). ... Создал и читает курсы лекций 'Электрослабые процессы в сильных электромагнитных полях', 'Взаимодействие элементарных частиц в электромагнитных полях' и 'Введение в физику нейтрино'. ... Neutrino and electrons in background matter: a new approach', Annales de la Fondation Louis de Broglie 31 (2006) ? ... Quantum treatment of neutrino in background matter', J. Phys. A: Math. ... Neutrino quantum states and spin light in matter' (with A.Ternov), Phys....

Еще в разделе: (Показать все результаты (>2) - theorphys.phys.msu.ru/ )

... Earlier still lies the remaining frontier, where the first stars, galaxies and massive black holes formed. ... Building on this general framework, and relying on the development of efficient new computational tools, the fragmentation properties of primordial gas inside such minihaloes were investigated with numerical simulations, leading to the result that the first stars, so-called population III, were predominantly very massive4,8 (see Box 1 for the terminology used here). ... Astrophys. ... III. ...

Еще в разделе: (Показать все результаты (>8) - ocean.phys.msu.ru/ )

звоните, мы в Москве(926)6667253 art-sale@mail.ru . Начало www.99ru.ru Виниловые пластинки Запад 15818 . ... Искусство . История.Философия . ... Художественные . ... История Всемирная . ... Искусство и культура . ... Другие виды искусства . ... Теория искусств.Эстетика . ... Этнография Фольклор . ... Фольклор . ... СССР (после 1917) . ... Введите код товара из каталога. автор Pink Floyd . ... Pink Floyd . ... Западных уже нет, остались кое-какие лицензионные СССР звоните, тел.сверху . ...

Еще в разделе: (Показать все результаты (>2) - www.bukivedi.ru/ )

• www.99ru.ru - Запад

... Географии мирового хозяйства . ... География" . ... 31 January 2015 Deadline for submitting abstracts for papers and posters . ... Thematic session ? ... Session title: Evolution of Earth Cryosphere in changing climatic conditions and . ... Monitoring of cryosphere components is essential in understanding climatic and environmental variability and trends. ... When submitting, first select the category and specific session in which you wish to place your abstract (see the session list). ...

Еще в разделе: (Показать все результаты (>79) - www.geogr.msu.ru/ )

• CONTENTS ?3 - 2011
• CONTENTS ? 6 - 2013
• CONTENTS ?6 - 2009

Fluorescence Spectral Imaging (FSI) Technique as a Probe of Photosensitizer Tissue Distribution Feofanov A.V.1,2, Karmakova T.A.3, Filonenko E.V.3, Sokolov V.V.3, Yakubovskaya R.I.3, Luk'yanets E.A.4, Kirpichnikov M.P.1,2 Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry RAS, ul. ... Comparative study of various PS is important to realize how the differences in molecular properties would affect tissue distribution, tumor accumulation, and, finally, the overall antitumor effect. ...

Еще в разделе: (Показать все результаты (>16) - www.msm.biophys.msu.ru/ )

• MSM 2007

... A comparative study of thermodynamic for both natural and artificial RNA/DNA ґ protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA ґ protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...

Еще в разделе: (Показать все результаты (>3) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2003.pdf

NANOSYSTEMS: PHYSICS, CHEMISTRY, MATHEMATICS, 2014, 5 (1), P. 195ґ202 USING ARTIFICIAL NEURAL NETWORKS FOR ELABORATION OF FLUORESCENCE BIOSENSORS ON THE BASIS OF NANOPARTICLES S. A. Burikov1 , S. A. Dolenko2 , K. A. Laptinskiy1 , I. V. Plastinin1 , A. M. Vervald1 , I. I. Vlasov3 , T. A. Dolenko1 2 Moscow ... .phys.msu.ru 1 PACS 61.46.+w, 87.64.-t, 07.05.Kf, 87.85.fk In this study, the results for the solution of the pattern recognition problem are presented -- extraction of ... Use of ANN. ...

Еще в разделе: (Показать все результаты (>9) - rswater.phys.msu.ru/ )

• http://rswater.phys.msu.ru/en/articles/2014/Using.pdf
• http://rswater.phys.msu.ru/en/articles/2013/opt%20mem.pdf
• http://rswater.phys.msu.ru/en/articles/2014/JBO_19_11_117007.pdf

External modules for the Gibbs program The Gibbs program has several built-in non-ideality models which can be used for the calculation of activity coefficients for real solutions: the extended Debye-HЭckel model for aqueous solutions, the modified Peng- Robinson model for gaseous (or liquid) solutions, the Non-Random-Two-Liquid model for liquid solutions, the Mixing-on-Sites model for solid solutions, Subregular and Redlich-Kister models for solid and liquid solutions. ... Attach external modules). ...

Еще в разделе: (Показать все результаты (>17) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/geochems/soft/en/Unitherm.doc
• Faculty of geology Moscow State Lomonosov University

Theory as a Lighthouse in the Electrochemical Ocean . In memory of Alexander M. Kuznetsov . ... Until his last days he continued to work on various aspects of charge transfer phenomena. ... In electrochemical kinetics the theory always outruns the experiment, and the quantum mechanical theory of charge transfer created in the famous Theoretical Department of the Frumkin Institute in Moscow (R.R. Dogonadze, A.M. Kuznetsov and co-authors) is a good example for that. ...

Еще в разделе: (Показать все результаты (>30) - electr003.chem.msu.ru/ )

• In memory of Sasha Kuznetsov
• Oleg A. Petrii
• Vladimir Sergeevich Bagotsky

MultiTest V.1.2, a program to binomially combine independent tests and performance comparison with other related methods on proportional data Thierry De MeeШs1,2*, Jean-FranГois GuИgan2 and Anatoli Teriokhin3 1 IRD, UMR 177 IRD-CIRAD "Trypanosomoses", Centre International de Recherche-DИveloppement sur l'Elevage en zone Subhumide (CIRDES), 01 BP 454, Bobo-Dioulasso 01, Burkina-Faso. ... All procedures more or less behaved consistently with ~5% significant tests at ?= ... and number of species in | ...

Еще в разделе: (Показать все результаты (>11) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2000_Fecundity_ProcRoySoc.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

178. Multiparameter Stability Theory with Mechanical Applications

179. Institute of Computer Sciences - Publications

180. http://storage.bioinf.fbb.msu.ru/~roman/bmc_genom_2013.pdf