... Department of Mathematical Physics . ... Springer: Журналы . Springer: Книги . ... Журнал Science . ... Журналы American Physical Society . ... Журналы NPG (Nature Publishing Group) . ... Журналы The American Mathematical Society . Журналы The Royal Society Publishing . ... The Royal Society Publishing (GreatBritain) . ... the Royal Society A: Mathematical, . ... the Royal Society B: Biological Sciences . Proceedings of the Royal Society A: Mathematical, Physical & Engineering Sciences . ...

Еще в разделе: (Показать все результаты (>66) - mph.cmc.msu.ru/ )

... Email . ... Department of Chemistry, Lomonosov Moscow State University, 1992 . ... D. (Organic Chemistry), 2002 . ... genie@qsar.chem.msu.ru . ... Department of Chemistry, Lomonosov Moscow State University, Leninskie gory 1/3, Moscow 119991 Russia . ... 7 (495) 939-3557 . ... medicinal chemistry, chemoinformatics, computer-aided drug design, QSAR, bioactivity, molecular modeling, virtual screening . ... Eugene_Radchenko . ... Radchenko, Eugene V. Home . ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>23) - qsar.chem.msu.ru/ )

• Home - Laboratory of Medicinal Chemistry
• Sosnina, Ekaterina A. - Laboratory of Medicinal Chemistry
• Palyulin, Vladimir A. - Laboratory of Medicinal Chemistry

Chemistry Department - Lomonosov Moscow State University . Inorganic Chemistry Division . Home . ... Division Colloquia . ... Inorganic Materials Sciences . Chemistry of Coordination Compounds . Inorganic Synthesis . Inorganic Crystallochemistry . Chemistry and Physics of Sensor and Semiconductor Materials . ... Inorganic Chemistry Division, Department of Chemistry, . Moscow State University, . ... 119991, GSP-1, Moscow, Russia . 7-(495)-939-2074, +7-(495)-939-0998 . ...

Еще в разделе: (Показать все результаты (>97) - www.inorg.chem.msu.ru/ )

• Inorganic Synthesis Laboratory people
• group alumni
• Group of Hydrothermal Synthesis :: Bulat R. Churagulov

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Въезд на территорию МГУ по пропускам. ( страницы 0 20 40 все ) . ... Нормативные акты, законы, постановления и т.д, касаемо общежития и МГУ ( страницы 0 20 40 все ) . ...

Еще в разделе: (Показать все результаты (>124086) - www.snto-msu.net/ )

• University (Archive) - Public forum of MSU united student networks
• Cистемник! Building for You - Public forum of MSU united student networks
• Продам computer без блока питания и HDD - Public forum of MSU united student

... Nonlinear spectroscopy . Nonlinear fiber optics . ... We actively collaborate with a number of Russian and foreign research groups and institutes . ... Texas A&M University, College Station , Texas, USA, [ web ] . ... Max Planck Institute for Quantum Optics, Garching, Germany [ web ] . ... P. K. Anokhin Institute of Normal Physiology, Russian Academy of Medical Sciences, Moscow [ web ] . ... P.N. Lebedev Physical Institute of the Russian Academy of Sciences, Moscow [ web ] . ...

Еще в разделе: (Показать все результаты (>10) - photonicslab.phys.msu.ru/ )

• Aleksei Zheltikov
• Contacts

... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...

Еще в разделе: (Показать все результаты (>2) - phys.msu.su/ )

... Полная версия этой страницы: Аспирантура в Johns Hopkins University . Студенческий форум Физфака МГУ > Физфак и учеба > Аспирантура . ... Факультет физики и астрофизики Johns Hopkins University объявляет набор студентов в аспирантуру на 2012/13 учебный год. ... http://physics-astronomy.jhu.edu/admiss/gr...dmiss_info.html . http://www.grad.jhu.edu/admissions/apply/index.php . ... Johns Hopkins University находится на севере города Балтимор (население 630 тыс.) в штате Мериленд. ...

Еще в разделе: (Показать все результаты (>641) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > набор в аспирантуру -- Johns Hopkins...
• Студенческий форум Физфака МГУ > PhD positions in Switzerland
• набор в аспирантуру -- Johns Hopkins University - Студенческий форум Физфака...

... Skobeltsyn Institute of Nuclear Physics, Lomonosov Moscow State University, Moscow 119991, Russia. ... 6 C r o s s s e c tio n ( 1 0 In the present study the animated crossed electron -ion beams method [1] is applied for measurement of absolute cross sections for electron impact single and multiple ionization of C+, N+ and O+ ions at incident electron energy values up to 2.5 keV. 6 6 (a) C 2+ (b) N 2+ cm ) 2 - 17 4 4 2 2 0 10 6 100 1000 0 10 100 ...

Еще в разделе: (Показать все результаты (>10) - lmmqsp.sinp.msu.ru/ )

• Laboratory of Mathematical Models of Quantum Scattering Processes / MSU

Information letter Dear colleagues! Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ґ Institute for Biomedical Problems, Russian Academy of Science would like to invite you to participate in the work of the VII Russian National School with International Participation on Muscle and Exercise Physiology ?New approaches to studying of classical problems?. ... Abstracts of reports will be published. ... The receipt of your abstract will be confirmed by e-mail. ...

Еще в разделе: (Показать все результаты (>11) - www.fbm.msu.ru/ )

• http://www.fbm.msu.ru/sci/sno/POST%20CARD%202011.pdf

... Sternberg Astronomical Institute , Moscow University . ... Present edition unites two parts of Catalogue of interacting galaxies by B.A.Vorontsov-Velyaminov: the first part (Part 1) containing 355 systems was published in 1959 [1] and the second one (Part 2) with 497 objects - in 1976 [2].Thus two published parts of Catalogue include 852 interacting systems. ... All new of them (1162 by number) were taken from the comments to the galaxies in Morphological catalogue by Vorontsov-Velyaminov et al.[ ...

Еще в разделе: (Показать все результаты (>26) - www.sai.msu.ru/ )

• Moscow Astronomical Plate Archives: Contents, Digitization, Current and

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Comparison of protein phylogeny reconstruction methods

Кафедра истории зарубежной литературы . филологического факультета МГУ им. М.В. Ломоносова . Department of History of Foreign Literatures, Lomonosov State University of Moscow (MGU) . About the department . ... Department history . Contact us . ... Phone: +7 (495) 939-27-84 . E-mail: zarubezh@philol.msu.ru . ... Кафедра истории зарубежной литературы филологического факультета МГУ . 7 (495) 939 27 84 . zarubezh@philol.msu.ru ...

Еще в разделе: (Показать все результаты (>10) - forlit.philol.msu.ru/ )

• About the department
• Department history
• Lectors

Moscow State Lomonosov University and Moscow Mathematical Society . are organizing International Conference . Topology, analysis and applications to mathematical physics" . ... The conference will be held in Moscow from February 14 to February 19, 2005 . ... Geometry and topology, analysis, applications to mathematical physics . ... Moscow Mathematical Society, . ... Seminar on Topology and Analysis . ... e-mail: soloconf@mech.math.msu.su . ... Date of birth: . ... E-mail: . ...

Еще в разделе: (Показать все результаты (>63) - dfgm.math.msu.su/ )

• 2nd Announcement
• Links
• Intro