Information Security Meeting Schedule Thursday, March 30 12:00 noon Opening and Catered Lunch 1:00 R. Sekar, Stony Brook University - Ongoing Research at Secure Systems Laboratory at Stony Brook University 1:30 Scott Craver, Binghamton University - Information Hiding and Counterdeception 2:00 Sanjay Goel, University at ...

Еще в разделе: (Показать все результаты (>26) - suny.msu.ru/ )

• Center on Russia and the United States :: Contacts
• Center on Russia and the United States :: Summary of SUNY/MSU Center Activities
• Center on Russia and the United States :: Currently available grants

... PE8_10 Production technology, process engineering PE8_11 Product design, ergonomics, man-machine interfaces PE8_12 Lightweight construction, textile technology PE8_13 Industrial bioengineering PE8_14 Industrial biofuel production PE9 Universe sciences : astro- physics / chemistry / biology ; solar system; stellar, galactic and extragalactic astronomy, planetary systems , cosmology; space science , instrumentation PE9_1 Solar and interplanetary ...

Еще в разделе: (Показать все результаты (>47) - ideas.msu.ru/ )

• http://www.msu.ru/int/newpr/7ram/7ram_info.pdf
• http://ideas.msu.ru/docs/press_release_StG_2012.pdf
• http://ideas.msu.ru/docs/press_release_2011.pdf

. contacts: . 119192, Ц. Moscow, Mitchurinsky prospect, 1 . Institute of Mechanics MSU, room112Ю . Phone: (495) 939-25-37 . Fax: (495) 939-38-68 . e-mail: vinograd@imeЯ.msu.ru

Еще в разделе: (Показать все результаты (>20) - termogaz.imec.msu.ru/ )

• staff_e

. РЕЙТИНГ СЛУХОВ . о проекте права пишите нам .

Еще в разделе: (Показать все результаты (>5) - www.niiss.ru/ )

Search of Novel Crystalline Materials , Study of their Properties and Crystallization Processes . ... The work of group for the search of novel crystalline materials are held at M.V. Lomonosov Moscow State University since 1964. The main aim of investigations are search and study of new promising multifunctional materials with unusual physical properties: ferroelectrics, superionic conductors, nonlinear optical materials, laser crystals, piezoelectrics, etc. ...

Еще в разделе: (Показать все результаты (>4) - newcryst.phys.msu.ru/ )

... News . ... 32-bit Microcontroller Programming . Microcontroller Control of Motors . Second-year students classes . ... Parallel Programming . ... Microcontroller Programming . ... Microcontroller-related . ... Alexander Karabutov . ... Alexander Iovlev . ... We sincerely wish you a Happy New Year and Merry Christmas! We hope that this year has been for you a year of new achievements. ... Happy New Year 2016! ... Hits . ... Written by Sergey Zapunidi . ... Written by Ольга Жулябина . ...

Еще в разделе: (Показать все результаты (>96) - engineering.phys.msu.ru/ )

• Parallel Programming
• Participation in INNOPROM-2015
• Anatoliy Sizov

... General Psychology . Psychophysiology . ... Social Psychology . ... Psychological Principles of Personality Correction . ... Historical Psychology of Personality . ... Psychophysiology of Functional States . ... Social Psychophysiology . ... Psychological Influences on a Person in Clinical Psychology . ... Non-Russian Social Psychology in 20 th Century . ... Social Psychology of Personality . ... Process of Investigation in Social Psychology . ... Qualitative Analysis in Social Psychology . ...

Еще в разделе: (Показать все результаты (>220) - www.psy.msu.ru/ )

• Psychology in Russia. Contacts
• Psychology in Russia. State of the Art. Editorial Board

... Astronomy search engine . ... PhysicsWeb Home Page . ... Sternberg Astronomical Institute . ... Astro Space Center Home Page . ... Landau Institute for Theoretical Physics . ... Astronomy and Space Physics Dept of Kiev University . ... NATIONAL RADIO ASTRONOMY OBSERVATORY Home Page . University of Hawaii - Institute for Astronomy . ... Space Telescope Science Institute Home Page . ... Sky & Telescope: The Essential Magazine of Astronomy . ... Springer LINK - Physics Online Library . ... Home . ...

Еще в разделе: (Показать все результаты (>474) - astro.uni-altai.ru/ )

... The Council on Complex Problems of Cosmic Rays of the Russian Academy of Sciences and the Skobeltsyn Institute of Nuclear Physics (SINP) of Lomonosov Moscow State University are planning to held a workshop "Cosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century" on May 16-18 2011 at the Moscow State University. ... The Workshop banquet will be held on Tuesday, May 17 th . ... Workshop тАЬCosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century"...

Еще в разделе: (Показать все результаты (>8) - tunka.sinp.msu.ru/ )

О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the љtwo-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>61) - erg.biophys.msu.ru/ )

• comcon1 ERG Research Group: Лаборатория теоретической биофизики
• Using RESP with GAMESS-US and Firefly (PC-GAMESS) ERG Research Group:
• Building and plotting Fukui function with FireFly and PyMol ERG Research Group:

Data are provided with the intent that they are readily available for personal and public non-commercial use and may be reproduced, in part or in whole and by any means, without charge or further permission from IWSG. However, proper reference to contributors of original data to the database must be provided in all cases, and due diligence should be exercised in ensuring the accuracy of the materials reproduced . ... Bird species report. In : ARCTIC BIRDS breeding conditions survey . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

системы автоматизации, автоматизированные системы , информационные системы , мобильные и встраиваемые системы , программное обеспечение, вычислительные системы , средства связи,базы данных, информационные технологии,технологии программирования, обработка изображения, параллельные вычисления, информационное моделирование,математическое моделирование, вычислительный эксперимент, информатика,методы вычислений, численный анализ, numerical ...

Еще в разделе: (Показать все результаты (>3) - adept.srcc.msu.ru/ )

General Information . ... Local Information . ... The city represents great cultural value because in the late 19th and early 20th centuries, Kislovodsk as a fashionable spa attracted many musicians, artists, and members of the Russian aristocracy. ... Double room with full pension (breakfast, lunch, dinner) - 2620 rubles per person per night. solnechniy . ... Citizens of most countries need visa to enter the Russian Federation. ... Victor Kornilov, Sternberg Astronomical Institute (chair) . ...

Еще в разделе: (Показать все результаты (>26) - site2010.sai.msu.ru/ )

• Participants

Кафедра истории зарубежной литературы . филологического факультета МГУ им. М.В. Ломоносова . Department of History of Foreign Literatures, Lomonosov State University of Moscow (MGU) . About the department . ... Department history . Contact us . ... Phone: +7 (495) 939-27-84 . E-mail: zarubezh@philol.msu.ru . ... Кафедра истории зарубежной литературы филологического факультета МГУ . 7 (495) 939 27 84 . zarubezh@philol.msu.ru ...

Еще в разделе: (Показать все результаты (>5) - forlit.philol.msu.ru/ )

• Lectors

... 2013/04/16 - 11:59am . Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Contact information . ... Site map . Site search . MSU website . Contacts . ... This site (RSS) . E -mail: info@hsmi.msu.ru . Phone: +7 495 932-80-73 . Fax: +7 495 932-80-73 . 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>28) - hsmi.msu.ru/ )

• Shmeleva Elena Vladimirovna | MSU Higher school of management and innovation

Welcome , Registration , and other StartingPoints ; TWiki history & Wiki style; All the docs.. ... Edit preference settings for TWiki.TWikiSkins . ... Find topics that link to TWiki.TWikiSkins .. ... Rename the TWiki web . ... Get a fresh page of the topic TWiki.TWikiSkins . ... Copyright by the contributing authors. All material on this collaboration platform is the property of the contributing authors. ... Note: Please contribute updates to this topic on TWiki.org at TWiki:TWiki.TWikiSkins . ...

Еще в разделе: (Показать все результаты (>32301) - dualopt1.cmm.msu.ru/ )

• TWikiAccessDotPm - TWiki - TWiki - (printable)
• TWikiAccessDotPm - TWiki - TWiki

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>10) - compmech.math.msu.su/ )

... Official address of the Faculty of Materials Science: . Leninskie gory 1, building 73, Lomonosov Moscow State University, Faculty of Materials Science, 119991 Moscow, Russia . Education Office . ... office 214, lab building B (bld. ... Tel: +7 (495) 939-45-51 . Fax: +7 (495) 939-09-98 . office . 237, lab building B ( bld . ... office 546, chemistry building (bld. ...

Еще в разделе: (Показать все результаты (>5) - www.fnm.msu.ru/ )

• Apply
• About

... Contact us . ... Art Director . ... e-mail: kreis@kge.msu.ru . Administrative Director . ... e-mail: tata-tsm@yandex.ru . ... Phone: 8(926)1667650 . e-mail: pasha2186@list.ru . ... Metro "Universitet", then buses 1, 113, 119, 661. 2008 The Early Music Theatre Text graphics . 2008 Sergei Shishkin Design ...

Еще в разделе: (Показать все результаты (>6) - www.tsm-msu.ru/ )

• The Early Music Theatre at Moscow State University

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>26) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Nhunt