... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
... In vitro, the protein S7 of Thermus thermophilus is able to form complexes with both the minimal 16S rRNA fragment and the intercistronic region of the str operon mRNA from E.coli (Kd = 1.4x10-7 M and 1.1x10-7 M respectively). ... The filter binding assay. ... The most striking result of our study is that thermophilic protein S7 binds strongly to the E.coli S12-S7 intercistronic region of str mRNA in vitro, inspite of the lack of the functionally analogous thermophilic extended region. ...
[
Текст
]
Ссылки http://rnp-group.genebee.msu.su/pdfs/febsz.pdf -- 49.2 Кб -- 21.10.2002
[
Текст
]
Ссылки http://rnp-group.genebee.msu.ru/pages/pdf/febs1998.pdf -- 49.2 Кб -- 18.02.2008 Похожие документы
Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...
Кафедра высокопроизводительных вычислений МГУ . Главная . ... Главной задачей кафедры является организация и осуществление на высоком уровне учебно-воспитательной работы по подготовке специалистов высокой профессиональной квалификации по высокопроизводительным вычислениям на многопроцессорных ЭВМ из числа студентов 2-5 курсов механико-математического факультета , физического факультета , факультета вычислительной математики и кибернетики, химического факультета и других факультетов ...
Hybrid Molecular Mechanics : For Effective Crystal Field Method for Modeling Potential Energy Surfaces of Transition Metal Complexes M. B. DARHOVSKII/-2 M. G. RAZUMOV/ A. L. TCHOUGREEFF12 1 3 I. V. PLETNEV,2' 4 L. Y. Karpov Institute of Physical Chemistry , Moscow , Russia 2 Center for Computational Chemistry at the M. V. Keldysh Institute/or Applied Mathematics of RAS, Moscow , Russia 3N. S. Kurnakov Institute of General and Inorganic ... 2002 Wiley Periodicals, Inc. ...
[
Текст
]
Ссылки http://analyt.chem.msu.ru/preconcentration/pletnev/papers/ijqc2k3/ijqc2k3p1.pdf -- 23.6 Кб -- 25.11.2006 Похожие документы
... Студенты, обладающие визой F-1 в Соединенных Штатах Америки , теперь могут сделать изменения, объявленные в апреле, в программе Общего практического обучения. Срок программы обучения был продлен от 12 месяцев до 29 и теперь позволяет определенным студентам визы F-1 работать в США по профессиям, относящимся к области обучения студентов. ... Data Processing and Data Processing Technology/Technician. ... Architectural Engineering Technology/Technician. ... Civil Engineering Technology/Technician. ...
... Graduated in 1963 from the Faculty of Mechanics and Mathematics (Moscow State University). ... Honorary Doctor of Tokai University (Japan), Honorary Doctor of Istanbul University (Turkey), Honorary Doctor of Mongolian University , Honorary Doctor of Hanoi National University (Viet-Nam), Honorary Doctor of Byelorussian State University , Honorary Doctor of Yerevan University (Armenia), Honorary Doctor of Tashkent University (Uzbekistan), Honorary ...
Московский государственный университет имени М.В. Ломоносова . ... Рассказ о факультете . ... Символика факультета . Новости факультета . Вакансии факультета . ... Программы подготовки на факультете . ... Приемная комиссия факультета . ... Перевод из другого вуза и между факультетами МГУ . ... Полезные ссылки . ... Курсы . ... Факультет иностранных языков и регионоведения МГУ имени М.В. Ломоносова . ... 2000 - 2016 Факультет иностранных языков и регионоведения МГУ имени М.В. Ломоносова . ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... Foundation of Physics Group University of Bari (headed by Professor Augusto Garuccio, garuccio@fisica.uniba.it), Department of Physics, Bari, Italy; . ... University of Geneva, Group of Applied Physics, Division of Optics (headed by Professor Nicolas Gisin, Nicolas.Gisin@physics.unige.ch). Joint INTAS project; . ... National University of Singapore, Faculty of Science, Department of Physics (headed by Professor C. Oh) and Laboratory of Quantum Information (headed by Professor Arthur Ekert). ...
Theoretical Department of the Institute of Electrochemistry AN USSR . ... Yuri A. Chizmadgev - Frumkin Institute, Moscow . Boris M. Grafov - Frumkin Institute, Moscow . Vladislav Yu Filinovskiyi - Frumkin Institute, Moscow . Semen I. Kuchanov - Moscow University (Dept of Physics) and Nesmeyanov Institute, Moscow . ... Michael I. Urbakh - Tel-Aviv University, Tel-Aviv . Yuri G. Chirkov - Frumkin Institute, Moscow . ... Igor G. Medvedev - Frumkin Institute, Moscow . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
О кафедре . ... Наглядная и компью терная геометрия и топология . ... Г.В.Носовский. ... Математические заметки, т. 33, вып. 2, 1985, с. 325-333. ... Об условиях, возникающих при оценке производных решений стохастических дифференциальных уравнений в римановых пространствах.. ... Тезисы Бакинской международной конференции по топологии и ее приложениям. ... В.В.Калашников, Г.В.Носовский, А.Т.Фоменко. ... Г.В.Носовский, А.Т.Фоменко. ... Вып. ... А.А.Голованов, Д.П.Ильютко, Г.В.Носовский, А.Т.Фоменко. ...
Papers submitted to QUALICO-94 . ... Anoshkina J.G. Morphological Processor for the Russian Language . ... Baskevich V.M. Statistical Analysis of Lexical Units in Texts of Different Functional Styles) . ... Breiter M.A. Length of a Chinese Word in Relation to its other Systemic Features . ... Kazakevich O.A. Minor Languages of Russian on Computer . ... Moscalenko T.A. Quantitative Analysis of Different Levels Lexical Units Distribution in Legislative Texts: Word forms, Lexemes, Hyperlexemes] . ...
... The Council on Complex Problems of Cosmic Rays of the Russian Academy of Sciences and the Skobeltsyn Institute of Nuclear Physics (SINP) of Lomonosov Moscow State University are planning to held a workshop "Cosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century" on May 16-18 2011 at the Moscow State University. ... The Workshop banquet will be held on Tuesday, May 17 th . ... Workshop тАЬCosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century"...
... в рамках регулярного семинара по проекту Живой камень: от минералогии к мифопоэтике состоится доклад Олеси Темиршиной . ... Приглашаются участники проекта, сотрудники Института, а также все желающие. 2-3 сентября, 10.30-13.45: 4 лекции по курсу 'История науки' РАШ РГГУ (м. Новослободская, центральный вход РГГУ, далее 5 корп., 7 подъезд, комната 105) . ... 6 сентября, 10:00 Специальная сессия Института мировой культуры Живой и мертвый камень и вокруг . ... Институт мировой культуры МГУ 2003-2014 . ...
To use Microsoft Outlook Web access, browser settings must allow scripts to run. ... If your browser does not support scripts, you can download Microsoft Internet Explorer for access to Outlook Web Access. ... Select this option if you use Outlook Web Access on a public computer. ... This is a private computer . ... Use Outlook Web Access Light . ... Type the address for Outlook Web Access into the field, click Allow, and then click OK to save your changes. Connected to Microsoft Exchange . ...
Irena Lasiecka ( University of Virginia ) . Nikolai Melnikov (CEMI / MSU) . Mikhail Zelikin (MSU / Steklov Institute) . G. Avalos ( University of Nebraska , USA ) . V. Borisov (MSU, Moscow) . ... O. Emanouvilov ( Colorado State University , USA ) . A. Fursikov (MSU, Moscow) S. Hansen ( Iowa State University , USA ) R. Hildebrand ( Joseph Fourier University , France) V. Komornik ( University of Strassburg, France ) A. Kowalewski ( Institute of Automatics, Poland ) . ... Moscow) . ...
Summary Progress Report 2010 2014 UNESCO Chair on Global Problems and Emerging Social and Ethical Challenges for Large Cities and Their Population at the Faculty of Global Processes of the Lomonosov Moscow State University Period of activity: September 2010 June 2014 Title of the Chair : UNESCO Chair on Global Problems and Emerging Social and Ethical ... Visit of UNESCO Director-General Irina Bokova at Moscow State University September 9, 2011. ...
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-1.pdf -- 1926.1 Кб -- 13.09.2014 Похожие документы
... Расписание заседаний Десятого международного форума "Партнерство государства, бизнеса и гражданского общества при обеспечении международной информационной безопасности". ... Институт проблем информационной безопасности МГУ имени М.В.Ломоносова начал подготовку к Десятому международному форуму "Партнерство государства, бизнеса и гражданского общества при обеспечении международной информационной безопасности", который состоится 25-28 апреля 2016 года в г. Гармиш-Партенкирхен, Германия. ...