... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• ConClus
• Align tool for DNA-protein complexes

Communicating Through Art, L.Vershbow . ... But here I am, and as a designer, I will attempt to explain to you how I perceive art and design as a form of communication. Most of us think of art as the works that hang in museums and on the walls of our homes. ... But art, design and symbols, whether they are aesthetically pleasing or not, are all around us, and they help to guide us through the complexities of everyday society. ... Today I am a designer and creator of contemporary jewelry. ...

Еще в разделе: (Показать все результаты (>24) - suny.msu.ru/ )

• Center on Russia and the United States :: Summary of SUNY/MSU Center Activities
• Center on Russia and the United States :: Currently available grants
• Center on Russia and the United States :: Links

данных о себе // режимы работы // старт - приглашения для регистрации, редактирования // регистрация // редактирование (personal_id= password = все в строке запроса) // загрузка файла loadfoto (она же смена файла) // require _once($ GLOBALS [ DOCUMENT_ROOT ]. / mikromag /script/config.php3 ); require _once($ GLOBALS [ DOCUMENT_ROOT ]. / ...

Еще в разделе: (Показать все результаты (>73) - genphys.phys.msu.su/ )

• Index of /mikromag/script
• Index of /mikromag/script/admin

Bird Species Database (BSD) is being compiled in a framework of the Arctic Birds Breeding Conditions Survey (ABBCS) of the International Wader Study Group (IWSG). BSD aims at providing information on distribution, numbers and breeding status of birds in the Arctic, with the focus on last-breaking and, thus usually unpublished information. The primary source of data is questionnaires filled in by contributors to the ABBCS, while data from literature are being added occasionally. ... breeding . ...

Еще в разделе: (Показать все результаты (>2) - arctic.ss.msu.ru/ )

sparallel.ru . Older posts . Newer posts . Posted by admin . ... Continue reading . Posted in Туфли . Фев 02 . ... Posted in Кеды . ... Posted in Разное . ... Posted in Кросовки . ... На сегодняшний день кеды Supra являются самой удобной обувью для катания на скейте. ... Posted in Ботинки . ... Каким только интерпретациям не подвергался бессмертный роман А. Continue reading . Posted in Сапоги . ... Черутти обувь . ... Тигина обувь каталог . ... Весна лето обувь 2012 Рубрики . ...

Еще в разделе: (Показать все результаты (>646) - sparallel.ru/ )

• admin | sparallel.ru - Part 298
• admin | sparallel.ru
• sparallel.ru - Part 99

. Science . People . Education . News . For 1st and 2nd-year students . Introduction to quantum physics . FAQ . 2nd-year course work topics . About us . Contacts . En . Ru . Learn more about the special courses . Basics of quantum physics . FAQ . Information coursework 2 courses . 28 / October 2013 . Science . People . Education . News . For 1st and 2nd-year students . About us . Contacts . 2003 2016 Department of Quantum Electronics . +7 (495) 939-11-04 . chair@shg.phys.msu.ru . Войти

Еще в разделе: (Показать все результаты (>44) - quantum.phys.msu.ru/ )

• About us | Department of Quantum Electronics
• All news | Department of Quantum Electronics
• Contacts | Department of Quantum Electronics

Fortran 90 User 's Guide A Sun Microsystems, Inc. Business 2550 Garcia Avenue Mountain View, CA 94043 U.S.A. Part No.: 801-5492-10 Revision A, March 1995 © 1995 Sun Microsystems, Inc. 2550 Garcia Avenue, Mountain View, California 94043-1100 U.S.A. All rights reserved. This product and related documentation are protected by copyright and distributed under licenses restricting its use, copying, distribution, and decompilation. No part of this product or related documentation may be reproduced in any form by

Еще в разделе: (Показать все результаты (>27) - smdc.sinp.msu.ru/ )

• http://smdc.sinp.msu.ru/doc/UserGuide.pdf

Status of mTCA Slow Control development at CMS Petr Volkov1 D. V. Skobeltsyn Institute of Nuclear Physics, M. V. Lomonosov Moscow State University Leninskie Gory 1, 119991 Moscow, Russia The CMS experiment at the LHC at CERN has decided to upgrade their readout hardware at a large scale from VME to MicroTCA. ... As a typical use in the HEP environment the applying of SCADA system WinCC OA will be discussed for a Detector Control System (DCS) of several sub detectors. ...

Еще в разделе: (Показать все результаты (>164) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2015/Qfthep_mTCA_PVolkov.pdf
• Programme
• Programme'2013

Information Extraction and Integration from Big Data (Web, Social Media, Texts, ...) . ... Hadoop, Map/Reduce. IBM BigInsights. : · · , ; (entities) ( , , , , .) AQL; , (matching) (resolution) (linking), (deduplication) (entity resolution); () , , ( , , ); , . ... HIL (Highlevel Integration Language, , IBM, Map/Reduce), AQL, . http://synthesis.ipi.ac.ru/synthesis/student/BigData), « - » « ». ...

Еще в разделе: (Показать все результаты (>2) - master.cmc.msu.ru/ )

Cooperation with Third Country participants Cooperation with Third Country Participants in an EC funded FP7 multi-partner research project1 - Practical Advice for Proposal Submission and Negotiation ­ What are Third Country Participants in this context? ... For a complete list of associated countries see ftp://ftp.cordis.europa.eu/pub/fp7/docs/third_country_agreements_en.pdf. ... 2 Cooperation with Third Country participants account by the coordinator already at the proposal stage. ...

Еще в разделе: (Показать все результаты (>34) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/CSA_guide_2008.pdf
• http://ideas.msu.ru/docs/guide_for_applicants_StG_2012.pdf
• http://ideas.msu.ru/docs/Guide_SyG_2012.pdf

... 8 OpenFlow , , , , , , NAT, ARP, DNS, DHCP, BGP , , web · ­ · events per second · >10M · "" ­ · us · ­ 24/7 · ­ : ­ (2013) · · · · · · · · · NOX-Classic NOX Beacon Floodlight SNAC Ryu POX Maestro Trema · · · · · · · · · Helios FlowER MUL McNettle NodeFlow Onix SOX Kandoo Jaxon · Cisco ONE controller · Nicira NVP Controller · Big Network Controller · IBM Programmable Network Controller · HP SDN Controller · NEC Programmable Flow 11 · ­ ­ · ­ · ­ · ­ OpenFlow 12 5/30/2013 13 (2013) · 7 000 000 . ...

Еще в разделе: (Показать все результаты (>7) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~bahmurov/course_realtime/papers/balashov_et_al_eucass2011_monitoring.doc

High-peak-power diode-pumped picosecond lasers for scientific, technological and navigational applications International Laser Center of M.V.Lomonosov Moscow State University All-solid-state technology Excellent beam quality Output and input triggering Widely tunable repetition rate Electro-optical operation control Microcontroller design Internal auto-diagnostics Compactness and ease of operation No water cooling Low power consumption PICAR ...

Еще в разделе: (Показать все результаты (>81) - ilc.phys.msu.ru/ )

• "Computers and measurements" practical course laboratory

... Submit a Paper . Before submitting your paper for the ICONO/LAT 2013 please read the guidelines for preparation of the conference papers. We manage all paper submissions for the ICONO/LAT 2013 with the help of the Lomonosov Scientific Portal developed at the Lomonosov Moscow State University specifically for the conferences needs. Pushing the button below you will leave the conference site and go to the Lomonosov portal for papers submission. ... Program overview . ... Registration info . ...

Еще в разделе: (Показать все результаты (>13) - iconolat13.phys.msu.ru/ )

• Invited speakers
• Visa to entry Russia

... OLYMPIAD of NSC. This letter contains information about scientific contest - Olympiad, which is held yearly in Chernogolovka: a small pictures- que village not far from Moscow, in which the Noginsk Scientific Center (NSC) of the Russian Academy of sciences is situated. The contest is participated by pupils of the 8-th to the 11-th forms and consists in solving problems in physics, astronomy and mathema- tics. The Olympiad is one of interesting traditions of our scienti- fic centre. ...

Еще в разделе: (Показать все результаты (>15) - www.issp.ac.ru/ )

• Founding Statutes
• II International Olympiad of Euro-Asian Astronomical Society

... This is a bug fix release for the 3.x series of Joomla. ... Project and the Production Leadership Team are proud to announce the release of Joomla! 3.5 as the latest in the 3.x series. ... CMS 3.5 Release Candidate 4 . ... CMS, with 3.5 the sixth standard-term support release in this series. ... That being said, please do not upgrade any of your production sites to the release candidate version as a release candidate is ONLY intended for testing and there is no upgrade path from a Release Candidate....

Еще в разделе: (Показать все результаты (>4) - biophys.phys.msu.ru/ )

Molecular mechanism of activation of cytokinin receptors, playing crucial role in plant growth and development . ... Modeling of the glutamate NMDA receptor, design and virtual screening of its ligands as potential neuroprotector agents to treat Alzheimer's disease, Parkinson disease and schizophrenia . ... Design of small molecule antiviral compounds against tick-borne encephalitis, dengue fever, and other diseases caused by flaviviruses . ... Research . ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>7) - qsar.chem.msu.ru/ )

... Выпускники . ... Женский клуб . ... Издательство МГУ . ... Выпускники МГУ . ... Дайв-Клуб МГУ . ... GetWebResourceUrl(Page owner, Type type, String resourceName, Boolean htmlEncoded) +82 System.Web.UI.ClientScriptManager.RenderWebFormsScript( HtmlTextWriter writer ) +58 System.Web.UI.Page.RenderWebFormsScript( HtmlTextWriter writer ) +26 System.Web.UI.Page.BeginFormRender( HtmlTextWriter writer , String formUniqueID) +387 System.Web.UI.HtmlControls.HtmlForm.RenderChildren( HtmlTextWriter ...

Еще в разделе: (Показать все результаты (>443) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: "Внутренние часы" тела можно повернуть вспять, доказали
• Клуб выпускников МГУ: КАК ОБОСНОВАТЬСЯ В КАНАДЕ: ПЕРВЫЕ ШАГИ (часть 15,
• Клуб выпускников МГУ: Обсуждение материала "Никлаус Вирт в России"

... 2013/04/16 - 11:59am . ... After the education at High School of Management and Innovation graduates receive the state approved diploma of Lomonosov Moscow State University for a specialized educational programme "Strategic Management and Innovation" and become "Masters of Management". ... Admission procedure in 2013 in direction of "Management" for the programme "Strategic Management and Innovation" provides for contracts with 50 persons . ... 2006-2016 MSU Higher School of Management and...

Еще в разделе: (Показать все результаты (>15) - hsmi.msu.ru/ )

• We are assembling training courses! | MSU Higher school of management and
• MSU Higher school of management and innovation |
• School overview | MSU Higher school of management and innovation

... The optimal control, which led oscillatory system to a certain energy level from any initial conditions at minimum time, is found. ... A set of points where the trajectory becomes an arc of a circle with the other center is called the switching line. ... For drawing switching line near the origin (see for example Figure 3) we note from the system (1) that time is proportional to the sum of the angles 214 this sums for optimal and quasi-optimal processes. ... The control function (14) is not optimal....

Еще в разделе: (Показать все результаты (>10) - belyakov.imec.msu.ru/ )

The paper of Eugene Babaev "Intuitive Chemical Topology Concepts" . ... These objects with quite different geometrical properties have homeomorphic 2 D surfaces, which can be continuously deformed one to another or to the same surface of a torus. ... This approach (a generalization of our earlier works [29-33]) allows us to apply the homeomorphism concept to chemical problems in a new way, classifying molecular structures and reactions from the viewpoint of the topology of surfaces. ... Surfaces . ...

Еще в разделе: (Показать все результаты (>123) - www.chem.msu.ru/ )

• Mathematical Chemistry
• CURRICULUM VITAE
• Eurasian Meetings on Heterocyclic Chemistry