... Laboratory of Problems for Magnetism, . ... Study of the magnetic and transport properties of R-3d intermetallic compounds with a magnetic instability of the itinerant-electron subsystem. ... const at high temperatures (Curie-Weiss law) [A.S. Markosyan, Y. Hosokoshi, K. Inoue, Phys. Lett. ... Gaidukova, Y. Hosokoshi, K. Inoue, A.S. Markosyan , Magnetic phase diagram and pressure effect on the magnetic properties of the Y 1? x Gd x Mn 2 intermetallic compounds, J. Phys.: Condens. ...

Еще в разделе: (Показать все результаты (>21) - ferro.phys.msu.ru/ )

• http://ferro.phys.msu.ru/lab6/eng/dubenko.htm
• http://ferro.phys.msu.ru/lab6/eng/granovsky.htm
• http://ferro.phys.msu.ru/lab6/eng/rodimin.htm

... В.И.Дмитриев Электромагнитные поля в неоднородных средах Изд-во Моск. ун-та, Москва 1969, с.131 . ... Изд-во 'Диалог-МГУ', 1997,с.168. ... Прикладная математика и информатика', Изд-во 'Диалог-МГУ', 1999,с. 68-77. ... Прикладная математика и информатика', изд-во 'МАКС Пресс', Москва, 2001г.,?7, с.5-18. ... В трудах 'Прикладная математика и информатика', ?2, Изд-во 'Диалог-МГУ', 1999,с. 5-17 . ... Сборник работ 'Прикладная математика и информатика', изд-во 'МАКС Пресс', Москва, 2001г., ?9, с. 46. ...

Еще в разделе: (Показать все результаты (>2) - lmph.cmc.msu.ru/ )

• Лаборатория Математической Физики.

The Lomonosov Moscow State University Faculty of Educational Studies The MSU FES offers various educational programs: 1. Master program "Education Management"; 2. ... Qualification training programs "School Teacher" and "Higher School Teacher". The FES was founded in 1997 with the main goal to teach those students of the MSU faculties who wished to receive the qualification of Secondary and Higher School teacher & lecturer in addition to their basic speciality. ...

Еще в разделе: (Показать все результаты (>2) - fpo.msu.ru/ )

... Вакансии . ... Ярмарки вакансий и выставки . ... Technical Requirements Analysis (Functional Decomposition and Call Flows). Provide Business Requirement Specifications, Software Requirement Specifications, and Product Feature Descriptions. ... Substantial experience in requirement analysis and requirement management. ... In order to expand the development of our product globally, jNetX is currently looking for a Requirement Analyst to Product Management Department, based in Moscow. ...

Еще в разделе: (Показать все результаты (>161) - www.physcareer.ru/ )

• Solution Centre Engineer (Graduate) / Вакансии / Physcareer.ru
• ЗАО КБ 'Ситибанк' ПРИГЛАШАЕТ НА РАБОТУ / Вакансии / Physcareer.ru
• Стажер - группа стратегии, компания KPMG / Стажировки / Physcareer.ru

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>3) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...

Еще в разделе: (Показать все результаты (>48) - nanofluidics.phys.msu.ru/ )

• Research

The final deadline for pre-registration and abstract submission is 20 May 2002. ... Workshop Proceedings are available for download. 30 Sep 2002 . Information on Workshop Proceedings . 28 Aug 2002 . Venue of the Workshop . 12 Jul 2002 . Workshop program is available now! ... 24 May 2002 . Visas to Russia? ... Information on accomodation in Petropavlovsk. New topic "1952 Kamchatka tsunami" was added. ... Information . ... Tel: 7(095) 939-3698 Fax: 7(095) 124-8713 . ...

Еще в разделе: (Показать все результаты (>33) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION -- Official information

... A Primer from the Reform of Personal Income Taxation in Russia Introduction. ... However, to use the welfare function one needs to aggregate individual preferences that can also be unknown. ... The derivations lead to the conclusion that the optimal marginal income tax rate is increasing as the elasticity of labor supply increases. ... In this paper we obtain the characteristics of the labor supply for different population groups to get the elasticities of labor supply with respect to a post tax...

Еще в разделе: (Показать все результаты (>866) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./briedis.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./paliulis_chlivickas.pdf

... Rete 1. Forgy, Charles L. "Rete: A Fast Algorithm for the Many Pattern/Many Object Pattern Matching Problem." Artificial Intelligence, Vol. 19, ? ... Proceedings of the Fifth National Conference on Artificial Intelligence, AAAI, Philadelphia, 1986, pp. ... Scales, D. "Efficient matching algorithms for the SOAR/OPS5 production system." ... Proceedings of the Sixth IEEE Conference on Artificial Intelligence Applications, 1990, pp. ... TREAT: a better match algorithm for AI production system." ...

Еще в разделе: (Показать все результаты (>95) - sp.cs.msu.ru/ )

• Темы докладов, курсовых и дипломных работ. 1998-1999 учебный год
• Explicit cyclic schemes for space neutron kinetics in (Hex-Z) geometry
• RAMPA - CASE for portable parallel programs development

... Science Park . ... Agency for networking, information and communication technologies ( NETINFOKOM LLC) ank-nic@rambler.ru http://www.msunews.ru/ . ... Developing the infrastructure and information support needed for projects that provide an interdisciplinary exchange of science information and the potential for collective work on the base of network services and technologies. ... The company has a great deal of experience in the design, development and penetration of laboratory information systems. ...

Еще в разделе: (Показать все результаты (>14) - www.sciencepark.ru/ )

• MSU Science Park - News

Site navigation: . ... Publications . ... SPDC Laboratory . Quantum Electronics Chair . ... Site configuration . Error: You currently have Javascript disabled. ... The problem of preparing entangled pairs of polarization qubits in the frequency-nondegenerate regime?, ... Download [ help ]: . Download paper: doi page . Download paper: Full text . ... All persons copying this information are expected to adhere to the terms and constraints invoked by each author's copyright. ...

Еще в разделе: (Показать все результаты (>69) - qi.phys.msu.ru/ )

XXVIII General Assembly of the IAU, SPS15 Beijing, August 31, 2012 . N.N. Samus, S.V. Antipin "Variable Stars and Data-Intensive Astronomy" . During the 26th IAU General Assembly in Prague, the IAU Division V (Commissions 27 and 42) considered the future of variable-star catalogues. ... To discuss these problems and to look for their solutions, the IAU Commission 27, on behalf of the IAU Division V, created an informal working group, chaired by the GCVS editor, Dr. Nikolai Samus. ...

Еще в разделе: (Показать все результаты (>71) - sai.msu.ru/ )

• Презентация PowerPoint
• ГАИШ: Государственный астрономический институт имени Штернберга

... 5-я летняя школа по геометрическим методам математической физики, 23-26 июня 2015 г. new . ... Лаборатория "Геометрические методы математической физики" была создана в декабре 2010г. после объявления победителей гранта Правительства Российской Федерации для государственной поддержки научных исследований, проводимых под руководством ведущих ученых в российских образовательных учреждениях высшего профессионального образования. ... на семинаре "Геометрия и группы" состоится доклад: . ...

Еще в разделе: (Показать все результаты (>4) - dubrovinlab.msu.ru/ )

Magnetism Department MSU . ... Research groups . ... Students . Phd students . ... The basics of spintronics. prof . Vedyaev ю. Actual problems in modern magnetism . prof . Granovsky A. The physical basics of magnetism . associate prof . Kotel'nikova O. Magnetic phase transitions. associate prof . Kotel'nikova O. Physics of magnetic phenomena. associate prof . Kotel'nikova O. Introduction in group theory and its application in physics of magnetic phenomena. associate ...

Еще в разделе: (Показать все результаты (>29) - magn.phys.msu.ru/ )

• Information about education on magnetism division
• Полезные ссылки

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

... The scientific and investigating activities of the laboratory are spread in three main dimensions. ... Leading Research Associate Gibalov V.I. Assistant of professor Tkachenko S.N. Senior Research Associate Samoilovich V.G., Kozlov K.V., Popovich M.P. New Effective Enamel Coating of HF-ozonizers Electrodes . ... assistant of professor Antipenko E.E. Senior Research Associate Zosimov A.V. Ozone Including Oxidation Reactions . ... NON-TRADICIONAL METHODS OF CHEMICAL AND CATALYTIC REACTIONS PERFORMANCE...

Еще в разделе: (Показать все результаты (>49) - www.kge.msu.ru/ )

• Ozone Workshop
• Archive

Announcement On November 2-3, 2005 Lomonosov Moscow State University will conduct jointly with the Academy of Cryptography of the Russian Federation the Fourth All- Russian Conference Mathematics and Security of Information Technologies [Cybersecurity?] and jointly with the Center of International Studies, Cambridge University , United Kingdom, Advanced Research Workshop Unconventional ... Sherstyuk V.P. - Security Council of the Russian Federation; 3. ... Organization Committee 1. ...

Еще в разделе: (Показать все результаты (>25) - suny.msu.ru/ )

• http://suny.msu.ru/ru/ProgramMaBIT05En.doc
• Center on Russia and the United States :: Other Russian Programs

... профессор А.М. ДЕНИСОВ . профессор В.И. ДМИТРИЕВ . ... профессор А.В. БАЕВ . профессор А.В. РАЗГУЛИН . ... доцент И.В. ДМИТРИЕВА . ... Обыкновенные дифференциальные уравнения . ... Дифференциальные уравнения и математическая физика . ... А.М. Денисов. ... Дифференциальные уравнения. 2009 год, том 45, ? ... А.М. Денисов, Е.В. Захаров, А.В. Калинин, В.В. Калинин. ... Inverse problem for a semilinear functional-differential wave equation. ... 2008. ... Г.В. Борисенко, А.М. Денисов, А.С. Крылов. ...

Еще в разделе: (Показать все результаты (>59) - mph.cmc.msu.ru/ )

русский english MSU of Lomonosov Higher School . of Policy in Culture . and Administration in Humanities (faculty) . ... Magistracy . ... Management in Culture . Management in Sport . ... Faculty in the people . ... academic adviser of the Higher School of Policy in Culture and Administration in Humanities (faculty) in Lomonosov Moscow State University. ... Higher School of Policy in Culture and Administration in Humanities (faculty Lomonosov Moscow State University) 2016 . ...

Еще в разделе: (Показать все результаты (>27) - hsscm.msu.ru/ )

• Management in Sport - Magistracy - Higher School of Policy in Culture and
• Programs - Higher School of Policy in Culture and Administration in Humanities
• Magistracy - Higher School of Policy in Culture and Administration in

... PhD thesis title: Gauge dependence of effective action in quantum gravity. ... Research fields of interest . Combustion: nonlinear development of the Darrieus-Landau instability of premixed flames, nonlinear flame stabilization and steady flame propagation, asymptotic methods, small gas expansion limit, non-perturbative description of curved flames, flame propagation in gravitational field, propagation of diffusion flames in counterflows. ... Gauge-independent effective gauge fields. ...

Еще в разделе: (Показать все результаты (>7) - theorphys.phys.msu.ru/ )