Twilight observations with MASS/DIMM B. Safonov Sternberg Astronomical Institute Moscow State University Comprehensive Characterization of Astronomical Sites, 2010 B. Safonov (Moscow State University) Twilight observations with MASS/DIMM SITE 2010 1 / 17 Why observe in twilight with MASS/DIMM? ... ASM includes 3 devices sensitive to background: guider, DIMM and MASS. B. Safonov (Moscow State University) Twilight observations with MASS/DIMM SITE 2010 2 / 17 Background in guider. ...

Еще в разделе: (Показать все результаты (>30) - site2010.sai.msu.ru/ )

• http://site2010.sai.msu.ru/static/doc/VKornilov_site2010.pdf
• http://site2010.sai.msu.ru/static/doc/TTravouillon_TMT_site_testing_site2010.pdf
• http://site2010.sai.msu.ru/static/doc/OVoziakova_site2010.pdf.pdf

30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...

Еще в разделе: (Показать все результаты (>3) - cosrad.sinp.msu.ru/ )

• http://cosrad.sinp.msu.ru/experiments/tus/doc/Ponce2007fin.pdf
• http://cosrad.sinp.msu.ru/experiments/tus/doc/HO2COSPAR2006.pdf

. Please standby and you will be automatically connected to the new location of the unframed Supernova page. Or, click on the link above. If you have questions or problems, please email me at David Bishop dbishop@vhdl.org . Last modified: Mon Aug 27 12:40:15 EDT 2001

Еще в разделе: (Показать все результаты (>428) - www.rochesterastronomy.org/ )

• Supernova 2006E in NGC 5338
• Supernova 2002dv and 2002eg in UGC 11486

... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ґ velocity potential, H ґ depth, ґ vector of bottom deformation, 0 ґ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>15) - ocean.phys.msu.ru/ )

... 000, 1ґ13 (2010) Printed 21 September 2011 A (MN L TEX style file v2.2) A universal ultraviolet-optical colourґcolourґmagnitude relation of galaxies I1gor V. Chilingarian1,2, and Ivan Yu. ... Received 2011 Sep 15; in original form 2011 Feb 6 ABSTRACT The bimodal galaxy distribution in the optical colourґmagnitude diagram (CMD) comprises a narrow "red sequence" populated mostly by early-type galaxies and a broad "blue cloud" dominated by star-forming systems. ...

Еще в разделе: (Показать все результаты (>8) - kcor.sai.msu.ru/ )

... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... https://cs.msu.ru/node/1707 . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>16) - ani.cmc.msu.ru/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU | Department of the
• The ASR Department at the CMC Faculty of Lomonosov MSU
• Courses | Department of the Automation for Scientific Research CMC MSU

. Лаборатория биофизики клетки: Объявления о семинарах и др. / . comments . Правка . Недавние изменения . Настройки . RSS Atom . Comments in the moderation queue : 1 . Recent comments on posts in the blog : . RSS Atom . Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:07 2015

Еще в разделе: (Показать все результаты (>29) - cell.biophys.msu.ru/ )

• seminar-03.12.2015
• seminar-14.04.2015

... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...

Еще в разделе: (Показать все результаты (>8) - physcontrol.phys.msu.ru/ )

... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...

Еще в разделе: (Показать все результаты (>3) - sa.cs.msu.ru/ )

Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia eґmail: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the soґcalled Vґ Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY YґMP supercomputers. al structure of the program. ...

Еще в разделе: (Показать все результаты (>7) - asa.guru.ru/ )

... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>2) - www.imec.msu.ru/ )

• EUROMECH Colloquium-458

. Клуб выпускников МГУ (Московский Государственный Университет) . Abstract: The problem of truth in science - the most urgent problem of our time - is discussed . Добавить сообщение . Страница сайта http://www.moscowuniversityclub.ru . Оригинал находится по адресу http://www.moscowuniversityclub.ru/services/messages.asp?forumId=0 =8488 .

Еще в разделе: (Показать все результаты (>324) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: CRISIS IN THEORETICAL PHYSICS: THE PROBLEM OF SCIENTIFIC
• Клуб выпускников МГУ: Конференция "Выпускники МГУ в США"

XXIII ICTAM, 19ґ24 August 2012, Beijing, China CASES OF INTEGRABILITY IN DYNAMICS OF A RIGID BODY INTERACTING WITH A RESISTANT MEDIUM Maxim V. Shamolin Institute of Mechanics, Lomonosov Moscow State University, Moscow, 119899, Russian Federation Summary The author discovers new integrable cases of the rigid body motion in a resisting medium, including those in the classical problem of motion of a spherical pendulum placed in the over-running medium flow. ...

Еще в разделе: (Показать все результаты (>44) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-136-1.pdf
• http://shamolin2.imec.msu.ru/art-112.pdf
• Mathematical Reviews

... On the Geological and Physical Mechanisms of Natural Processes in Dynamic Geology Problems N. V. Koronovskii, A. A. Naimark, V. S. Zakharov, and G. V. Bryantseva Department of Geology, Moscow State University, Moscow, Russia e mail: koronovsky@rambler.ru, fnaim@ya.ru, vszakharov@yandex.ru, bryan@geol.msu.ru Received March 30, 2015 Abstract--The applicability of the abstract physical mechanisms in studies of concrete geological processes is considered. ... MOSCOW UNIVERSITY GEOLOGY BULLETIN Vol. ...

Еще в разделе: (Показать все результаты (>27) - dynamo.geol.msu.ru/ )

• V.Zakharov's Ph.D. thesis
• Summaries of articles

... News . ... TLE news . ... Publications on Transient luminous events . ... The UHECRs will be detected through the measurement of the emission in the range between 290 and 430 nm, where some part of Transient Luminous Events (TLEs) emission also appears. ... Luminous event parameters (atmosphere altitude, energy released to radiation, and temporal pro?les) are similar to observed elsewhere parameters of transient luminous events (TLE) of elves, sprites, halo, and gigantic blue jets types. ...

Еще в разделе: (Показать все результаты (>44) - uhecr.sinp.msu.ru/ )

• Global transients in ultraviolet and red-infrared ranges from data of
• UHECR news
• Новости КЛПВЭ

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• ConClus

About particularities of intensities distribution in cross-section of powerful laser beams . ... The time of the beam aperture scanning was about 10 -2 - 10 -3 s. On occasion to measure the intensity distribution in the beam cross-section the small spherical mirrors with the diameter of about 5 - 10 mm were placed instead of mirror fringes. ... Such technique allowed by character of a luminescence corundum to investigate transformations of spatial distribution of intensity in a laser beam. ...

Еще в разделе: (Показать все результаты (>8) - optics.sinp.msu.ru/ )

• НЕСТАЦИОНАРНЫЕ РЕЖИМЫ ГЕНЕРАЦИИ В ПРОТОЧНЫХ ЛАЗЕРНЫХ СИСТЕМАХ И НОВЫЕ

... Cell Bio/., ... The mean length of microtubules surrounding the centrosome in different cell lines differed insignificantly and equalled 0.4-0.8 ?m. In this case, the microtubules attached to the centrosome were on the average slightly shorter than the free ones. ... Histogram of microtubule distribution by length around the centrosome in cells. radiating outward from the cell center also does not exceed 2 ?m. Short microtubules are prevalent: those of 0.2-0.4 ?m make up 34% of attached ones. ...

Еще в разделе: (Показать все результаты (>37) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/alieva94.pdf
• http://cellmotility.genebee.msu.ru/html/articles/komarova2002.pdf
• http://cellmotility.genebee.msu.ru/html/articles/vorobjev2002CBI.pdf

. 21.04.2014-23.04.2014 . Вход . Enter .

180. http://lvk.cs.msu.su/~sveta/SDN_OpenFlow_controllers_lecture2.pdf