... О UNИX . ... Comments . ... The comments will usually be rendered slightly different from normal text (e.g. different colour), so the user can still see what is main content and what is a comment. ... Some normal text. {{{#!wiki comment This is just a wiki parser using a div class="comment" to contain its output. 1. first 1. second 1.. ... You can set the visibility of comments in your user preferences, the default is to not show comments (so you need to click on Комментарии to see them). ...

Еще в разделе: (Показать все результаты (>261) - uneex.mithril.cs.msu.su/ )

• HelpOnInstalling/TroubleShooting - UNИX
• Index of /static/AltDocs_informatika1/Book1/5_html/8_form/1_work
• Index of /static/AltDocs_informatika1/Book1/4_text/223_Emacs/02_work

News of PARALLEL.RU par-news на mail.parallel.ru . ... Разработка грид-сервиса управления заданиями ГридННС Pilot на основе архитектурного стиля REST . http ://agora.guru.ru/parallel ------------- НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru / news / + Intel представляет секцию параллельное программирование конференции TechDays.ru. http ://www.techdays.ru/category/21.html + Georgia Institute of Technology создает Institute for Data and High Performance Computing ...

Еще в разделе: (Показать все результаты (>124) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #339 [06/02/2013]
• PARALLEL.RU - Новости, выпуск #269 [11/08/2009]

... Master . Master net Homepage . ... MASTER-Amur . ... Amb: . Dust: . ... Direct . 23s . ... 45s . ... observed area: . best limit: . Cameras . ... MASTER-Tunka . ... MASTER-Ural . master.kourovka.ru . ... MASTER-Kislovodsk . ... MASTER-Crimea . ... MASTER-SAAO . ... MASTER-IAC . ... MASTER-Argentina . master.sai.msu.ru:8080 . master.sai.msu.ru . ...

Еще в разделе: (Показать все результаты (>193) - master.sai.msu.ru/ )

• SAI Space Monitoring Laboratory

. Sternberg Astronomical Institute . Moscow, Russia . GCVS Research Group . Catalogues of Variable Stars . What's new . Recent publications . Send questions and comments to Olga Durlevich . visitors from 16 November 2001. Russian Foundation for Basic Research

Еще в разделе: (Показать все результаты (>107) - sai.msu.ru/ )

• General Catalogue of Variable Stars: Description
• General Catalogue of Variable Stars: Vols I-III (the new electronic version).
• GCVS Research Group: History and Persons.

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• StructAlign help

Еще в разделе: (Показать все результаты (>8) - mguteam.chat.ru/ )

• About Work Outs on Our Team

... Глобальные модели . ... глобальное . ... JGR, 82, 239-255 . ... cф.гарм. до 3-го пор.=60њ ячейка . ... cф.гарм. до 7-го пор. ... JGR, 89, 5953-5986 . ... JGR, 99, 6945-6980 . ... JGR, 98, 9793-9823 . ... 1995) . JGR, 100, 24037-24059 . ... JGR, 101, 27791-27810 . ... Van der Hilst et al. ... JGR, 103, 30055-30078 . ... JGR, 1995, 6829-6852 . ... Van der Hilst (1995) . ... Widiyantoro and Van der Hilst (1996) . ... Widiyantoro and Van der Hilst (1997) . ... Van der Voo et al. ...

Еще в разделе: (Показать все результаты (>16) - sbmg.geol.msu.ru/ )

• Ссылки на сейсмотомографические сайты
• Форма 502
• Ф-502

... Новости . ... Музей . антропологии . ... Вестник МГУ Антропология . ... 26 ноября Музее антропологии открылась этнографическая выставка . ... Антропология" . ... Посмотреть фотографии . ... 2008-2010 Научно-исследовательский институт и Музей антропологии им.Д.Н.Анучина . Копирование материалов web-сайта только с разрешения администрации НИИ и Музея антропологии МГУ! ... При использовании материалов, размещенных на сайте НИИ и Музея антропологии МГУ, ссылка на источник обязательна! ...

Еще в разделе: (Показать все результаты (>27) - www.anthropos.msu.ru/ )

... ECOLOGICAL COOPERATION" . ... Brjanskaja oblast, Dubrovskij rajon, Seshcha (village), School . Brjanskaja oblast, Djat'kovskij rajon, Bytosh (village), School . ... Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Borodino (village), School . Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Yardenikha (village), School . ... Moscow, Children's Ecological Center of the National Park "Losinyj Ostrov" - the coordinator of ecological work of 18 Korolev-town's schools . Moscow, School #222 . ...

Еще в разделе: (Показать все результаты (>207) - www.ecocoop.ru/ )

• The Ecological Cooperation project is the first large scale childrenтАЩs

... research | ... Matvey Viktorovich Youdov . ... Organic Chemistry Division, Chemistry Department, Lomonosov Moscow State University, Leninskie Gory, 199899 Moscow, Russia. ... B.S./M.S. in Chemistry "Study of structure of humic substances and their hydrolysis products by 1H and 13C nuclear magnetic resonance spectroscopy techniques" Employment: . ... Current research activity is dealing with investigation of structure of hydrolyses products of humic substances by methods of NMR spectroscopy. | ...

Еще в разделе: (Показать все результаты (>4) - www.mgumus.chem.msu.ru/ )

• MGUMUS -- Ekaterina A. Ilyukhina

Tentative academic program of Summer School in Coastal Ecology and Biological Safety (June 14-26, 2010; White Sea Biological Station) Version of January 27, 2010 Module I (4 days ): Invertebrates' Diversity of Coastal Zone Lectures + seminars, boat and short hiking excursions, laboratory work , individual work a) Main groups of invertebrates: the resident and endemic species of the W hite Sea b) Gathering and ...

Еще в разделе: (Показать все результаты (>8) - www.bio.msu.ru/ )

... Home Our Team Staff Lora S. Nikolaeva . ... Kalinin, USSR; graduated from Lomonosov Moscow State University, Mechanics and Mathematics Department in 1961. Work at Lomonosov Moscow State University, Chemistry Department from 1967. ... Joint investigstions with Department of Chemistry of Tver State University and Biology Department of Lomonosov Moscow State University have been made. ... Colloquium on 24.12.12 20 Dec 2012 . ... Department of Chemistry . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• PhDi Laboratory of Chemical Thermodynamics
• Valery P. Vassiliev Laboratory of Chemical Thermodynamics
• Carbamide Laboratory of Chemical Thermodynamics

... Run source ./setup.csh 6. ... When you will start to work next time, run setups in following order : cd /data1/atlas/work source ../software/12.0.8/setup.csh cd testarea/12.0.8/ source $ATLAS_ROOT/../work/cmthome/setup.csh -tag=12.0.8 To exclude first two lines, just add to your .login these lines : # add Atlas env-s : source /data1/atlas/software/12.0.8/setup.csh After that next time just do : source $ATLAS_ROOT/../work/cmthome/setup.csh -tag=12.0.8 cd /data1/atlas/work/testarea/12.0.8/ . ...

Еще в разделе: (Показать все результаты (>15) - lhe.sinp.msu.ru/ )

• Brief CompHep Installation Instruction

МГУ имени М.В.Ломоносова Русская версия . ... Geography . ... 29 Feb 2016 . ... Head of Department of Economic and Social Geography of Russia, Chair of Commitee of Scientific and Research work, Doctor of Geography. ... Prof. Alexandr Gennadiev - Deputy Head of Department of Landscape Geochemistry and Soil Geography, Doctor of Geography. Prof. Kirill Dyakonov - Head of Department of Physical Geography and Landscape Science, Corresponding Member of Russian Academy of Sciences, Doctor of Geography. ...

Еще в разделе: (Показать все результаты (>30) - conf.msu.ru/ )

... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...

177. University Satellites and Space Science Education '2006

178. Abstract

179. RELEC Mission: Relativistic ELECtron Precipitation and TLE Study on-board Small

180. Факультет фундаментальной медицины МГУ