... профессор А.М. ДЕНИСОВ . профессор В.И. ДМИТРИЕВ . ... профессор А.В. БАЕВ . профессор А.В. РАЗГУЛИН . ... доцент И.В. ДМИТРИЕВА . ... Обыкновенные дифференциальные уравнения . ... Дифференциальные уравнения и математическая физика . ... А.М. Денисов. ... Дифференциальные уравнения. 2009 год, том 45, ? ... А.М. Денисов, Е.В. Захаров, А.В. Калинин, В.В. Калинин. ... Inverse problem for a semilinear functional-differential wave equation. ... 2008. ... Г.В. Борисенко, А.М. Денисов, А.С. Крылов. ...

Еще в разделе: (Показать все результаты (>40) - mph.cmc.msu.ru/ )

Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>9) - lmmqsp.sinp.msu.ru/ )

Announcement On November 2-3, 2005 Lomonosov Moscow State University will conduct jointly with the Academy of Cryptography of the Russian Federation the Fourth All- Russian Conference Mathematics and Security of Information Technologies [Cybersecurity?] and jointly with the Center of International Studies, Cambridge University , United Kingdom, Advanced Research Workshop Unconventional ... Sherstyuk V.P. - Security Council of the Russian Federation; 3. ... Organization Committee 1. ...

Еще в разделе: (Показать все результаты (>14) - suny.msu.ru/ )

• http://suny.msu.ru/ru/ProgramMaBIT05En.doc
• Center on Russia and the United States :: Other Russian Programs

... Expanding and Retaining Customer Loyalty with Stefan Legner of InterNetX . Legner started with a brief history of InterNetX, a Regensburg, Germany based hosting and domain registrar provider that has more than 19,500 customers worldwide.He emphasized the need for companies to build long term partnerships, adding that business has always been about the relationship between people rather than companies .Where possible, Legner said that companies should provide an ... cheap the north face . ...

Еще в разделе: (Показать все результаты (>64) - elana.sinp.msu.ru/ )

• ralph lauren outlet uk 6 million cars worldwide | С Днем Победы!
• cheap moncler uk 4 16v loss of oil pressure at 2000rpm | С Днем Победы!
• michael kors outlet uk reports surfaced that AWS may open up to three data

... In this article, the light propagation in a diffuser with optically soft inclusions is described with the help of the Fokker­Planck equation, i.e., a transfer equation with a diffusion term in the space of radiation-propagation directions. The coefficient of angle diffusion is calculated using the Mie theory. The equation is solved numerically using the stochastic analog method, and the space and angle distribution of the radiation that passed through the diffuser is calculated. ...

Еще в разделе: (Показать все результаты (>18) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/science.html
• http://lizard.phys.msu.su/home/science/sust-2003-17-443.pdf
• http://lizard.phys.msu.su/home/science/Masyukov-Dmitriev-09-FPM-InN.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>4) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

DOI: 10.7256/2222-1972.2014.5.14682 doi « »: ( ) : . ... 526 © NOTA BENE ( «-») « » XI ., ... 527 © NOTA BENE ( «-») : 5 (23) · 2014 DOI: 10.7256/2222-1972.2014.5.14682 . ... XVI­XVIII . ... NOTA BENE ( «-») DOI: 10.7256/2222-1972.2014.5.14682 , [1, 7]. ... 529 © NOTA BENE ( «-») : 5 (23) · 2014 DOI: 10.7256/2222-1972.2014.5.14682 ­ , : « , " "». ... NOTA BENE ( «-») DOI: 10.7256/2222-1972.2014.5.14682 , « » [14, 155]. ... NOTA BENE ( «-») 533 : 5 (23) · 2014 DOI: 10.7256/2222-1972.2014.5.14682 27. ...

Еще в разделе: (Показать все результаты (>47) - www.hist.msu.ru/ )

Title Should Be in Bold, 18-Point Type and Centered, Please Use Title Case Author name(s) [10-point type, centered, bolded] Author affiliation and full address (8-point type, centered, italicized) Author e-mail address: (8-point type, centered, italicized) Abstract: Indent left and right margins 0.5 in. (1.27 cm), justify the paragraph (on both right and left), and use the same font as in the body of the paper. ... 5] Author(s), "Title of paper," in Title of Proceedings, Name(s), ed(s)., ...

Еще в разделе: (Показать все результаты (>5) - iconolat13.phys.msu.ru/ )

• Invited speakers

МГУ имени М.В.Ломоносова Русская версия . ... Section ?Psychology? ... 29 Feb 2016 . ... 15 Apr 2016 . ... Chair Yury P. Zinchenko, professor, Dean of the Faculty of Psychology MSU . ... Chair Yury P. Zinchenko, Dean of the Faculty of Psychology MSU, academician RAE . ... A.G.Asmolov chair of the department of Personal Psychology, academician RAE; . ... B.S.Bratus chair of the department of General Psychology, corresponding member RAE; . ... Actual problems of sport psychology and healthy lifestyle. ...

Еще в разделе: (Показать все результаты (>62) - conf.msu.ru/ )

... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...

172. http://ferro.phys.msu.ru/lab6/eng/rodimin.htm

173. Publications :: Quantum Information Laboratory

174. http://polly.phys.msu.ru/en/news/attach/2012-04-05-lectures-Farle.pdf

175. http://new.mfk.msu.ru/uploads/attachments/attachment_188_1454312707.doc

176. staff:guterman:conf_engl.html | Кафедра высшей алгебры

177. http://polit.msu.ru/pub/2015_11_30/C2015.doc

178. http://uzmu.phys.msu.ru/issue/120101.pdf

179. http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-1.pdf

180. Student Reports at International Conferences