. Summary of experimental results . The light absorbing capacity of phytoplankton, estimated from Fo , and its photosynthetic activity (estimated as Fv/Fm ) are key characteristics of the primary processes of photosynthesis. We suggested a formula for calculation of the primary production of phytoplankton from these two characteristics and underwater irradiance. The probing data were used to plot vertical profiles of phytoplankton productivity in various regions of the Baltic, Norwegian, and South China

Еще в разделе: (Показать все результаты (>10) - www.biophys.msu.ru/ )

• MEASURING THE PHYTOPLANKTON PHOTOSYNTHESIS RATE USING A PUMP-AND-PROBE

... The data on UV glow of the atmosphere obtained in operation of one pixel of the TUS detector on board the Moscow State University "Universitetsky-Tatiana" satellite was taken into account in design of the updated TUS detector. ... The main feature of the design is use of MEMS technology scanning mirror controlled by the TUS computer, analyzing the recorded EAS data and directing the laser to the atmosphere spot, where back scattered Cherenkov light came from. ... Monitoring of UV intensity on-route....

Еще в разделе: (Показать все результаты (>3) - cosrad.sinp.msu.ru/ )

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>20) - observ.pereplet.ru/ )

... The two main ways of financing a business, equity financing and debt financing, will be discussed in this chapter. Equity Financing Equity capital is the amount of money that you and/or your partners put into the business or raise from other investors. Equity is not debt. While investors share in the profits (or losses) of the business, their investment is not a loan. ... Debt Financing With your equity capital in place, you are now in a position to approach lenders for a business loan. ...

Еще в разделе: (Показать все результаты (>19) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/pointstoconsider.doc
• http://www.innovation.msu.ru/english/neuromotioncasestudy.doc

... Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. November 11, 1997 . The Annotated Galactic Center . ... Constellations of nearby stars include Sagittarius , Libra , Scorpius , Scutum , and Ophiuchus . ... Open clusters include M6 , M7 , M18 , M21 , M23 , M24 , M25 . Globular clusters include M9 , M22 , M28 , M54 , M69 , M70 . ... About APOD > . ... NASA Technical Rep.: ...

Еще в разделе: (Показать все результаты (>23) - www.arcetri.astro.it/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Variety of Long-Eared Owls (Asio otus L.) Diet as Index of Habitats Usefulness. ... Owls draw to themselves attention, due to a number of such features, as a wide circulation practically in all natural zones, an originality of ecology, behavior and morpho-physiology; prospect synantropisation some species on a background of disturbing decrease in number of others, difficultly observable and, still, poorly studied. ... Adult owl brings young sparrow from birddealer to his fledgling. ...

Еще в разделе: (Показать все результаты (>45) - vertebrata.bio.msu.ru/ )

• http://vertebrata.bio.msu.ru/Shakhparonov_SEH12.pdf
• http://vertebrata.bio.msu.ru/pub07_waterbirds_part3.3.1.2.pdf
• http://vertebrata.bio.msu.ru/Curlew_Sandpipers_Calidris_ferruginea_on_their_breeding_grounds.pdf

... Properties of Stellar Populations in Isolated Lenticular Galaxies I. Yu. ... The resulting average ages of the stellar population in bulges and discs fill an entire range of possible values from 1.5 to 15 Gyr which indicates the absence in the isolated lenticular galaxies, unlike in the members of groups and clusters, of a certain epoch when the structural components are formed: they could have been formed at a redshift of z > 2 as well as only several billion years ago. ... 69 NGC 2350 No. ...

Еще в разделе: (Показать все результаты (>46) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/aa6758-06.pdf
• http://sn.sai.msu.ru/~sil/preprints/counter.pdf
• http://sn.sai.msu.ru/~sil/preprints/ar875.pdf

... Electronic journal Issue 4. 10 september 2004 Briedis V. Pareto Structures A great Italian economist Vilfredo Pareto (1848 ­ 1923) in his unique economics and sociology studies [1, 2] continuously emphasised the systematic approach, reviewing the society development problems. ... Formal model of Pareto Structure First of all, provide a formal mathematical model adequately featuring the Pareto Structure. ... Indeed, I was primarily interested in the classical (harmonic structure) model at s = 1. ...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./nekipelov.pdf

... The bathroom can be a place of vanity for some and considered to be the supposed-cleanest part of the property. ... borse hermes outlet , in all of the areas of the house, . borse chanel replica , the bathroom has some of the most challenging areas to clean considering the effort and the dirt you?ll get while cleaning its tub and commode. ... A true fashion lover always follows Gucci, are incredibly trend-setting logo and it is unquestionably breaking new grounds when considering design, . ...

Еще в разделе: (Показать все результаты (>70) - elana.sinp.msu.ru/ )

• editor | С Днем Победы!
• An outside wedding will be difficult for older relatives and for the people

... Geocryology department of MSU includes about 30 academic staff members and over 60 students. ... Courses Permafrost Dynamics The temperature mode of soil and dynamics of permafrost soils, cryogenic processes, and climate change influence on cryolithozone. The course defines a place and a role of permafrost in environment, gives knowledge of formation of seasonal frozen soils and permafrost. ... Field Training Field Training in Vorkuta Construction on permafrost: major problems. ...

Еще в разделе: (Показать все результаты (>62) - www.msu.ru/ )

• Post-graduate studies
• FACULTY OF PSYCHOLOGY
• Heads of Moscow University

... For the past years I have been working on the problem of synthesis of light curves of close binary systems, consisting of a normal star and a compact object (point object with fixed X-ray luminosity). ... Possible existence of a bright spot on the disk's lateral surface is taken into account. ... The last of then will be published in Gordon and Breach Publishers ( Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ... Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ...

Еще в разделе: (Показать все результаты (>16) - uranus.sai.msu.ru/ )

• Nikolay Bochkarev
• Irina Glushneva

Symbolic circuit-matrix processor and evaluator . ... This software is reliable over the range of benchmark circuit complexity (both *.CIR and *.MAT file). ... SYMBOL is a symbolic-algebra package which in contrast to REDUCE, MACSYMA, MAPLE, MATHEMATICA, MathLAB, MathCAD and other known multi-purpose systems is especially intended for analysis of any lumped, linear, time-invariant circuit. ... pure ASCII text . ... CIRSYM - SYMbolic CIRcuit processor used to format ASCII text file *.out for CALCSYM. ...

Еще в разделе: (Показать все результаты (>11) - astrometric.sai.msu.ru/ )

... О Школе . ... ВШБ МГУ - школе . ... Выпуски журнала . Выпуск 1/2009 . ... Менеджмент Выпуски журнала Выпуск 1/2009 . ... В статье рассматривается необходимость пересмотра подходов к управлению бизнесом в условиях глубоких кардинальных изменений в экономике и обществе в целом. ... Vikhanskiy, O.S. PARADIGM S CHANGE FOR BUSINESS MANAGEMENT . ... Naumov, A. I. NO CRISIS FOR MANAGEMENT . ... A strategic alliance is a recent and not very well studied phenomenon in Russian business. ... Школа бизнеса . ...

Еще в разделе: (Показать все результаты (>38) - www.mgubs.ru/ )

• Высшая школа бизнеса МГУ им. Ломоносова
• Выпуск 2/2011 | Высшая школа бизнеса МГУ им. Ломоносова

Japan Student Services Organization (JASSO) Student Exchange Support Program Scholarship for Short-term Study in Japan [as of January 2016] This scholarship is available for qualified international students who are accepted by Japanese universities under student exchange agreements on a short-term basis. ... 7) Students who have a minimum GPA of 2.30 / 3.00 as calculated using JASSO's GPA calculation method shown below, based on a transcript from the previous academic year. ...

Еще в разделе: (Показать все результаты (>112) - phys.msu.ru/ )

• http://phys.msu.su/upload/iblock/b5c/registration_form_march_2010_1.pdf
• Title

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... The flow rate of carrier gas was controlled by electronic flow meters with an accuracy of + 1 ml/min. By scanning and transmission electron microscopy and X-ray diffraction carried out a systematic study of morphology and composition of the crystal phase depending on the quantity of flow of the carrier gas ( argon ) . ... 2008-2014 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>22) - www.lssm.inorg.chem.msu.ru/ )

THOMSON ELECTRON X-RAY SOURCE FOR MEDICAL APPLICATIONS E.G. BESSONOV1, R.M. FESHCHENKO1*, M.V. GORBUNKOV1, V.I. SHVEDUNOV2 and A.V. VINOGRADOV1 1 2 P.N. Lebedev Physical Institute, 119991 Russia, Moscow Leninskii Prospect 53 Nuclear Physics Institute of Moscow State University, 119899 Russia, Moscow, Vorobyevy Gory Abstract A source of medical x-rays based on a 50 Mev storage ring and a quasi-continues picosecond laser is considered. ... Then the storage ring emittance is 0.1 mmmrad. ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

• http://miles.sinp.msu.ru/files/Instr&Exp_Tech_Engl.pdf
• Thomson Electron X-Ray Source for Medical Applications | Проект ЭЛЛАРИ

European Research Council IDEAS Coordination and Support Action (CSA) Call identifier: ERC -2009-SUPPORT Guide for Applicants Version: 16 July 2008 The Guide is published by the ERC -DIS on http:// erc .europa.eu It can also be downloaded from the CORDIS page on http://cordis.europa.eu European Commission FP7 Specific Programme IDEAS ... Consequently, the ERC needs to be rigorous in evaluating the very best science and researchers and in selecting innovative and "high risk/high gain" projects. ...

Еще в разделе: (Показать все результаты (>32) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/ERC_guide_preparation.pdf
• http://ideas.msu.ru/docs/Work_programme_2011.pdf
• http://ideas.msu.ru/docs/work_programme_2012.pdf

... CpAppro . ... TernAPI program . ... Home Our Developments CpAppro . ... The above equation is a linear combination of thermodynamic functions of the harmonic oscillator (Planck-Einstein functions). This approach is developed as a part of a universal method of approximating temperature dependences of standard thermodynamic properties for crystalline substances. ... Colloquium on 24.12.12 20 Dec 2012 . ... Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>21) - td.chem.msu.ru/ )

• Lora S. Nikolaeva Laboratory of Chemical Thermodynamics
• PhD Defence Laboratory of Chemical Thermodynamics
• PhDi Laboratory of Chemical Thermodynamics

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...