... 2000 .. ... Y3Al2(AlO4)3 Y3Fe2(FeO4)3 CaF2 ZnS , , , 0,24­6,00 1,1­1,5 0,15­12 0,4­14 0,65 2,5 8,0 0,65 11,0 4,8 9,0 1320 1200 82 363 243 164 590 343 527 489 106, K-1 8,2 14 18,4 7,4 (293 ), /( ) 0,13 6,7­8,0 ­ 17,2 La2S 3 0,5­25 8­12 8­14 10,0 14,8 14,4 ­ 1,7 ­ CaLa2S4 SrLa2S4 94 , 6, 2, 2000 , , La2S3 , Ce2S3 , Gd2S3 , Tb2S3 , Tm2S3 , Yb2S3 . La2S3 , 1170 -La2S3 , 1570 -La2S3 ( () Th3P4). ... MeS, -Ln2S3 MeLn2S4 (CT Th3P4). ... CaLa2S4 CaS + - CaLa2S4 . ... CaO La2O3 , , ­ CaLa2S4 , CS2 1270 .. ...

Еще в разделе: (Показать все результаты (>156) - www.pereplet.ru/ )

• Super Ratio

Educational Technology & Society 10(3) 2007 ISSN 1436-4522 : .. . ... 1995). . ... Education Technology & Society 9(1) 2006 pp. 422-427. [ .., 1993] . ... Education Technology & Society 5(1) 2002, pp 222-243. ... Brusilovsky P., 1995] Brusilovsky P. Intelligent learning environments for programming: The case for integration and adaptation // In: J. Greer (ed.) Proceedings of AI-ED'95, 7th World Conference on Artificial Intelligence in Education, Washington, DC, 16-19 August 1995, AACE, pp. ...

Еще в разделе: (Показать все результаты (>140) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/science/psyrussia/2013-3/2013_3_31-40.pdf
• http://www.psy.msu.ru/science/psyrussia/2009/kashapov.pdf
• http://www.psy.msu.ru/science/psyrussia/2013-2/kaczmarek_2013_2.pdf

Technical aspects of the search for anomalous Wtb couplings. ... Outline What we call anomalous Wtb couplings Operators and vertex approaches Anomalous couplings in production cross section Anomalous couplings in the decay of top quark Effective operators in the field theory: In the units where = c = 1, the fields of the SM have mass dimensions: scalar: vector: fermion: Every term ... Problems of vertex function approach: We use operators with different mass dimensions. ...

Еще в разделе: (Показать все результаты (>205) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2013/POZDEEVAQFTHEP13.pdf
• http://qfthep.sinp.msu.ru/talks/andrianov_qfthep2010.pdf
• http://qfthep.sinp.msu.ru/talks/QFTHEP2010_leonidov.pdf

... Main page News People . ... Master net Homepage . ... SAI MSU 20-21 March 2014 . ... Zel'dovich asteroid . ... YaB-100 conferences . ... Science committee: . ... E.S. Gorbovskoy (SAI MSU) . V.M. Lipunov ( chairperson, MSU, SAI) . G.V. Lipunova (SAI MSU) . ... M.V. Pruzhinskaya (SAI MSU) . A.M. Cherepashuk (MSU, SAI) . N.V. Tyurina (SAI MSU) . N.I. Shakura (SAI MSU) . ... The conference is organized by the Zel'dovich Moscow Astrophysics Seminar ( master.sai.m su.ru/osa/ ) . ...

Еще в разделе: (Показать все результаты (>17) - master.sai.msu.ru/ )

... Voronin А. Каrmanov D. Savin А. Electronic engineer: . ... Engineer ? ... Electrical design of microprocessor systems, creating software for control and monitoring earth and satellite stations. ... Programming, electrical and layout design of test equipment for testing the silicon matrix for experiment ATIC (Advanced Thin Ionization Calorimeter), creating software for calibration. Electrical design of readout electronics, creating software for collecting and analysis data for experiment NUCLEON . ...

Еще в разделе: (Показать все результаты (>3) - silab.sinp.msu.ru/ )

... Sections . ... Atlas "Birds of Moscow City" . ... Breeding bird atlas of European Russia . ... Annual report, issue 1 . ... The Fauna and Abundance of European Russia Birds", issue 1 . ... Br eeding bird atlas of European Russia . ... Project outputs : Accurate mapping of Russian birds in the 2nd European Breeding Bird Atlas, and a groundbreaking Atlas of Breeding Birds of European Russia . ... Atlas "Birds of Moscow City" Monitoring of common birds Breeding bird atlas of European Russia . ...

Еще в разделе: (Показать все результаты (>870) - zmmu.msu.ru/ )

• Section of the scientific public oriented projects
• Collection of books
• Monitoring of common birds

MEIS : ­ 2007 ­ 3/802 537.9 538.975 P.N.Chernykh, G.A Iferov., ... S. Abo, S. Ichihara, T. Lohner, F. Wakaya, T. Eimori, Y. Inoue, M. Takai, Nuclear Instruments and Methods in Physics Research B237 (2005) 72. ... D.P.Woodruff, Nuclear Instr. and Methods in Phys. Research B256 (2007) 293. ... T.Gustafsson, H.C. Lu, B. W. Busch, W. H. Schulte, E. Garfunkel, Nuclear Instr. and Methods in Physics Research B183 (2001) 146. ... L.R. Doolittle, Nuclear Instr. and Methods in Physics Research B9 (1985) 344. ...

Еще в разделе: (Показать все результаты (>138) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LIIWM/Nimb212_03_164Mashkova.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb206_838_Yamada_GCIB_CollisionsSolid.pdf
• http://danp.sinp.msu.ru/LIIWM/Nimb230_05_443Mashkova.pdf

... M.V.Lomonosov Moscow State University . ... Physicists from Lomonosov Moscow State University studied the dynamics of multiple cavitation bubbles excited by a fs laser superfilament and developed a new approach for their control by laser pulse energy and external focusing. For the first time an innovative method of controlling the dynamics of cavitation bubbles excited by the distributed laser-plasma source (filament) was demonstrated. ... 119991, Moscow, . ...

Еще в разделе: (Показать все результаты (>247) - phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

... Инновационная . структура МГУ . ... деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... This guide primarily deals with the issues relevant to the conception and creation stages of development, and much less with the implementation stage. ... Most importantly, the material on Start-Up Company Development is presented to help your start-up succeed. ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>36) - innovation.msu.ru/ )

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>3) - swx.sinp.msu.ru/ )

... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблемљ и для их преподавания. ...

Еще в разделе: (Показать все результаты (>2) - unesco.fgp.msu.ru/ )

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>3) - www.ccl.msu.su/ )

Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenko§, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia § Institute of Synthetic Polymer ... I.V. Perminova, et al. ...

Еще в разделе: (Показать все результаты (>117) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2008/2008-kulikova-detoxifying.pdf
• http://www.mgumus.chem.msu.ru/publication/2010/2010-kholodov-detoxifying.pdf
• http://www.mgumus.chem.msu.ru/publication/2007/perminova-preparation-2007.pdf

... MSU Chamber Orchestra . ... Chamber Orchestra of Moscow State University was born in 1967. ... It was originally formed as a chamber orchestra at the School of Mathematics and Mechanics but soon (since September 1967) transformed into a Chamber Orchestra of the Moscow State University. ... The Chamber Orchestra of Moscow State University won the first prizes in the 1-st and 2-nd All-Union festivals of non-professional arts. ... Moscow State University does not have its own School of Music. ...

Еще в разделе: (Показать все результаты (>73) - music.genebee.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Bonham G.M., Surin A. IP Videoconferencing in Graduate Professional Education: Collaborative Learning for Public Management Introduction. ... While technology offers a range of opportunities that a standard «chalk and talk» class could never match, questions about the educational value of the new digital media loom large. ... If so, how can technology more effectively promote student-centered learning? ... Collaborative IP Videoconferencing. ...

Еще в разделе: (Показать все результаты (>9) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./leigh.pdf

... 2 What is MATLAB ?? Basic Matrix Operations Script Files and M-files Some more Operations and Functions APPLICATIONS: Plotting functions .. ... Vectors are special forms of matrices and contain only one row OR one column. Scalars are matrices with only one row AND one column MATLAB Matrices 17 A matrix with only one row AND one column is a scalar. A scalar can be created in MATLAB as follows: » a_value=23 a_value = 23 MATLAB Matrices 18 A matrix with only one row is called a row vector. ...

Еще в разделе: (Показать все результаты (>9) - imaging.cs.msu.ru/ )

... Two horseradish peroxidase C (HRPC) mutants with substitutions in the active center, i.e., Phe41-->His and Phe143-->Glu, were compared to the wild-type recombinant enzyme expressed in Escherichia coli in terms of the enzymatic activity and stability under irradiation. ... The radiolytic inactivation of the wild-type and mutant forms of recombinant HRP suggested different binding sites for iodide, 2,2'-bis(3-ethylbenzothiasoline-6-sulfonate (ABTS), guaiacol, and O-phenylene diamine. ...

Еще в разделе: (Показать все результаты (>143) - www.enzyme.chem.msu.ru/ )

• proj_past

A.Nekipelov Modernization of Basic Research in Russia: Russian Academy of Sciences ( RAS ) Vision Joint Session of Russian Academy of Sciences, Institute of France Academy of Sciences and Academy of Technology of France Paris, 2010, September 28 1 RAS in Russian Basic Science Potential (per cent, 2008) Russian Federation Research Organizations 100,0 RAS 12,7 Overall Personnel ... Who is the main actor in research: an institute or a laboratory? ...

Еще в разделе: (Показать все результаты (>16) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Bassanini_Mosca_rev4.pdf

... Download NPG-explorer . ... Build nucleotide pangenome . ... Here we provide a table for 3 Brucella genomes: all: embl :CP002459 BRUMM chr1 c Brucella melitensis M28 chromosome 1 all: embl :CP002460 BRUMM chr2 c Brucella melitensis M28 chromosome 2 all: embl :CP003176 BRUAO chr1 c Brucella abortus A13334 chromosome 1 all: embl :CP003177 BRUAO chr2 c Brucella abortus A13334 chromosome 2 all: embl :CP002078 BRUPB chr1 c Brucella pinnipedialis B2/94 chromosome 1 all: ... Fix bugs....