... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...

Еще в разделе: (Показать все результаты (>17) - ferro.phys.msu.ru/ )

О лаборатории . ... Лаборатория теоретической биофизики . ... For lipid bilayer modelling the whole toolchain was built: from creating membranes to MD trajectory analysis. ... We use OPLS-AA with some includings; ?includings? are overlays on the standart GROMACS forcefield files. ... 4 комментариев " Lipid membrane MD modeling with GROMACS " . Python membrane generator for MD simulations ERG Research Group: Лаборатория теоретической биофизики написал (Февраль 14th, 2012 4:11 пп) . ...

Еще в разделе: (Показать все результаты (>25) - erg.biophys.msu.ru/ )

• Gaussian Cube files loader ERG Research Group: Лаборатория теоретической
• membrane ERG Research Group: Лаборатория теоретической биофизики
• comcon1 ERG Research Group: Лаборатория теоретической биофизики

... MPI_Win_fenc win); A[rank] = 4; MPI_Win_fenc win); MPI_Put ( .. ... MPI-2 I/O: MPI - -, , - , MPI « » - , , . ... int MPI _File_close( MPI_File *fh) INOUT fh () , fh , fh, , MPI _FILE_CLOSE int MPI _File_set_view( MPI_File fh, MPI _ Offset disp, MPI_Datatype etype, MPI_Datatype filetype, char *datarep, MPI _Info info) I I I I I I N N N N N N OUT fh () disp () etype () filetype () datarep () info () int MPI _File_get_view( MPI_File fh, MPI _ Offset *disp, MPI_Datatype *etype, ...

Еще в разделе: (Показать все результаты (>6) - angel.cmc.msu.ru/ )

Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>23) - mouse.genebee.msu.ru/ )

• Align tool for DNA-protein complexes
• ConClus

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

Еще в разделе: (Показать все результаты (>2) - saistud.sai.msu.ru/ )

... ОТЧЕТЫ СТУДЕНТОВ О ПРАКТИКЕ В САО . Лето 2001 года . ... Гришатовой Юлии . ... Для определения лучевых скоростей, FWHM (полной ширины на половине максимума) и интенсивности линия He I 6678.15А описывалась гауссианой ( рис.1 ). ... create/icat {P1} ztsh*.bdf . execute/catalog @@ set_lambda {P2} . execute/catalog @@ timing {P2} . execute/catalog @@ phase {P2} . ... create/table {P1}.tbl . ... create/column {P1}.tbl fwhm . execute/catalog @@ add_rv_curve_point {P2} {P1}.tbl . ...

Еще в разделе: (Показать все результаты (>16) - heritage.sai.msu.ru/ )

... Программы обучения . ... Пропустить категории курсов . ... Пропустить новости . ... от Администратор ЦДО Ф/Ф МГУ - Понедельник 4 Август 2014, 09:53 . 04 августа 2014 года в Интеллектуальном центре ? ... Российские ВУЗы все чаще переходят на дистанционное обучение . ... ДИСТАНЦИОННЫЕ ПОДГОТОВИТЕЛЬНЫЕ КУРСЫ ФИЗИЧЕСКОГО ФАКУЛЬТЕТА МГУ ПО ФИЗИКЕ И МАТЕМАТИКЕ Пропустить Страницы ЦДО в социальных сетях . ... Центр дистанционного образвания физического факультета МГУ им. М.В. Ломоносова 2007-2012 . ...

Еще в разделе: (Показать все результаты (>53549) - distant.phys.msu.ru/ )

• Уведомление

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>9) - npidb.belozersky.msu.ru/ )

... V.A. Khokhlova, A.E. Ponomarev; M.A. Averkiou; and L.A. Crum. ... Cavitation control by dual frequency high intensity focused ultrasound. 16th International Symposium on Nonlinear Acoustics (Moscow, Russia, 19-23 August 2002), p. 127. ... V.A. Khokhlova, M.A. Averkiou, A.E. Ponomaryov, L.A. Crum Generation of nonlinear signals by rectangular ultrasound sources in biological media. 16th International Symposium on Nonlinear Acoustics (Moscow, Russia, 19-23 August 2002), p. 26. ...

Еще в разделе: (Показать все результаты (>46) - acoustics.phys.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors ­ such as economic, ecological and political aspects of society. ... Play. ...

Еще в разделе: (Показать все результаты (>8) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./ulrich.pdf

... Publications . ... Borisov A. V. , Kilin A. A. , Mamaev I. S. , Tenenev V. A. The dynamics of vortex rings: leapfrogging in an ideal and viscous fluid . ... Vetchanin E. V. , Mamaev I. S. , Tenenev V. A. The Self-propulsion of a Body with Moving Internal Masses in a Viscous Fluid . ... Vetchanin E. V., Tenenev V. A., Shaura A. S., Motion control of a rigid body in viscous fluid, Computer Research and Modeling, 2013, vol. 5, no. 4, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>142) - ics.org.ru/ )

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>8) - swx.sinp.msu.ru/ )

Submitted by the Eurasian Universities Association MEMORANDUM of the Eurasian University Ranking Conference (Moscow, 19 - 20 November 2009) Noting the important contribution of university ranking pioneers into initiating the process of higher education institutions ratings; stating the public significance of rankings and their influence on education development ; understanding the responsibility of ranking authors for the ... Convention on Rankings: Main Principles 1. ...

Еще в разделе: (Показать все результаты (>81) - www.msu.ru/ )

• MSU Web Sites
• Faculty of Fine and Performing Arts
• Lomonosov Moscow State University Institute of Russian Language and Culture

... MSU Chamber Orchestra . ... Chamber Orchestra of Moscow State University was born in 1967. ... It was originally formed as a chamber orchestra at the School of Mathematics and Mechanics but soon (since September 1967) transformed into a Chamber Orchestra of the Moscow State University. ... The Chamber Orchestra of Moscow State University won the first prizes in the 1-st and 2-nd All-Union festivals of non-professional arts. ... Moscow State University does not have its own School of Music. ...

Еще в разделе: (Показать все результаты (>73) - music.genebee.msu.ru/ )

Программные средства построения интернет-атласов . ... В работе описывается разрабатываемая в НИВЦ МГУ технология и поддерживающие ее программные средства комплексного отображения разнородной пространственно распределенной информации, в том числе в среде Интернет. ... Описываемая технология состоит в подготовке на инструментальной машине файлов (HTML-страниц, файлов с программами управления данными и их визуальным представлением и файлов данных), представляющих собой Интернет публикацию. ...

Еще в разделе: (Показать все результаты (>15) - adept.srcc.msu.ru/ )

... Chair of Computer Methods of Physics . Department of Physics, M.V. Lomonosov Moscow State University . Create new account . ... Request new password . Username * . Enter your Chair of Computer Methods of Physics username. Password * . Enter the password that accompanies your username. ... Department of Physics M.V. Lomonosov Moscow State University , Chair of Computer Methods of Physics , 2014 . ... Let us know ! ...

Еще в разделе: (Показать все результаты (>4) - cmp.phys.msu.ru/ )

... Laboratory "Сryoelectronics" . Currently our group is working atљ experimental љstudying of nanoelectronic devices based on silicon, mostlyљsilicon nanowires and single-electron transistors. ... Suspended single-electron transistor made up from highly doped silicon on insulator (Laboratory of Cryoelectronics 2012)љ . ... E: This email address is being protected from spambots. You need JavaScript enabled to view it. P: +7 (495) 939-39-87 . ... 2016 Laboratory "Сryoelectronics" ...

Еще в разделе: (Показать все результаты (>16) - cryolab.phys.msu.ru/ )

• Molecular single-electronics
• Alexandr A. Parshintsev

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... Please enter your username or email address. You will receive a link to create a new password via email. Username or E-mail: . ... Password . ... Lost Password . ...

Еще в разделе: (Показать все результаты (>40) - lomonosov.sinp.msu.ru/ )

... about ERC . education . research . events . ... Being an effective way of acquiring knowledge, they also make a good addition to core lecture courses and involve students, postgraduates and scientists of other Russian higher education institutions and research centers in ERC activity in the initial stage. ... More information can be found at http://polly.phys.msu.ru/ru/unc/sconf.html . ... Conference on Development Prospects of Education and Research Centers in the Russian Federation . ...

Еще в разделе: (Показать все результаты (>19) - nano.msu.ru/ )