ФЕДОТОВ Михаил Валентинович доцент кандидат физ.-матем.наук: 1989 МГУ контакты: fedotov@cs.msu.su СЕМИНАРЫ: Математический анализ 1-2 семестры, 1курс-2поток Обыкновенные дифференциальные уравнения 3-4 семестры, 2курс-1поток НАУЧНЫЕ ИНТЕРЕСЫ: математическая физика дифференциальные уравнения численные методы математические модели нелинейной оптики ПУБЛИКАЦИИ: |V.Trofimov, M.Fedotov, A.Volkov, N.Tcherniega, V.Savranskii, S.Lan. ... факультет ВМК МГУ, МАКС Пресс, 2010. - 264 стр. | ... 1988. ...

Еще в разделе: (Показать все результаты (>12) - mph.cmc.msu.ru/ )

... Continental Lithosphere Beneath SE Brazil . ... CREST (Continental Rifts: Evolution, Structure and Tectonics) Project . Crust and Upper Mantle Structure of S. California . ... Surface wave dispersion and upper mantle structure beneath southern Germany . ... Tomographic P-wave velocity inversion for the crust and upper mantle structure beneath Alaska . ... Upper Mantle Velocity and Q Structure . ... Velocity structure and anisotropy of the crust and upper mantle in the Brooks Range, Alaska . ...

Еще в разделе: (Показать все результаты (>7) - sbmg.geol.msu.ru/ )

• Calendar Converter

... MSU Chamber Orchestra . ... 2000/2001 season: . ... Olga NAZAIKINSKAYA - soprano . ... Cantatas for Soprano and Tenor . The Prophet Jeremy's Lamentation for Soprano and Basso Continuo . ... Stabat mater for soprano, counter-tenor and strings . ... Trio sonata "La Raspona" for 2 violins, viola da gamba and basso continuo . ... Christmas concert . ... Alexander Listratov (cello) . ... Concert A-dur, for viola da gamba and strings . ... MSU Chamber orchestra . ... MSU CHAMBER ORCHESTRA . ...

Еще в разделе: (Показать все результаты (>5) - music.genebee.msu.su/ )

... Coordination of economic policies and convergence of economic performance are fundamental to the integration of national economies in the Community. ... When U.S. President Barack Obama enters his White House meeting with Israeli Prime Minister Benjamin Netanyahu on March 5 -- angling to dissuade Israel from attacking Iran's nuclear facilities -- there will be one seemingly mundane issue on his mind that he may be too uncomfortable to share with his guest: gasoline prices. ... 2004. ...

Еще в разделе: (Показать все результаты (>2) - practice.msu.ru/ )

Andreenko Alexander Stepanovich . Doctor of Physics and Mathematics(1994), . ... Magnetism, rare earth alloys and compounds, amorphous alloys, phase transitions. ... In 1971-1984 investigations of magnetocaloric effect in rare earth metals, compounds and alloys were taken. ... In 1980-1999 researches of magnetic and magnetoelastic properties of rare earth alloys were produced. ... Several Publications: 1) Andreenko A.S., Zvezdin A.K., Nikitin S.A., Popkov A.F. JETF, 1979,76,6, 2158-2165 . ...

Еще в разделе: (Показать все результаты (>14) - ferro.phys.msu.ru/ )

• Physics Faculty of Moscow State University.
• Department of General Physics and magneto-ordered matter. Physics Department of

... Носов А.М. Регуляция синтеза вторичных соединений в культуре клеток растений. ... Носов А.М. Функции вторичных метаболитов растений in vivo и in vitro . ... Bondarev N, Reshetnyak O, Nosov A. Peculiarities of diterpenoid steviol glycoside production in in vitro cultures of Stevia rebaudiana Bertoni. ... Суханова М.А., Бондарев Н.И., Горяева О.В., Андреева С.Е., Носов А.M. Ультраструктурная характеристика клеток растений и каллусных культур Stevia rebaudiana в связи с синтезом стевиол-гликозидов. ...

Еще в разделе: (Показать все результаты (>18) - plantphys.bio.msu.ru/ )

... Data . ... Models . Solar energetic particles . Paraboloid model . ... Neutron flux variations (RU) . ... This program package is intended to prognose the environment on the board of near-earth elliptic orbiting satellites in the open space as well as behind the Al shielding. ... Next is the required spectrum type (integral or differential). ... sp_x.txt - solar proton spectrum behind shielding, fluence . sn_x.txt - solar neutron spectrum behind shielding, fluence . ... Solar . ...

Еще в разделе: (Показать все результаты (>24) - smdc.sinp.msu.ru/ )

• Home - Space monitoring data center
• Space monitoring data center

SELECT data_key, data_value FROM xf_data_registry WHERE data_key IN ('options', 'languages', 'contentTypes', 'codeEventListeners', 'cron', 'simpleCache', 'routesPublic', 'bannedIps', 'styles', 'nodeTypes', 'smilies', 'bbCode', 'displayStyles', 'trophyUserTitles', 'reportCounts', 'moderationCounts') . ... Select Type . ... Ref . ... SIMPLE . ... PRIMARY . ... const . ... library/XenForo/ Autoloader.php . ... library/Zend/Registry.php . ... library/Zend/Config.php . ... library/Zend/Db/Select.php . ...

Еще в разделе: (Показать все результаты (>25) - osk.msu.ru/ )

• http://osk.msu.ru/forum/members/adollekautoto.2142/?_debug=1
• http://osk.msu.ru/forum/members/arbimeorirm.2192/?_debug=1
• http://osk.msu.ru/forum/members/catyfopwbex.2168/?_debug=1

Fulbright Summer School in the Humanities is held annually since 1997 under the aegis of the Fulbright Program in Russia, Moscow University and the Russian Association for American Studies in partnership with a number of American universities. ... The goals of the Summer School are . ... It also helps develop the necessary bi-lingual and bi-cultural communication skills among Russian and American students/scholars providing impetus for innovative research and relevant publications. €а . ...

Еще в разделе: (Показать все результаты (>7) - discours.philol.msu.ru/ )

• discours

. SVETKA, a program for Analysis of Multiple Sequence Alignments . Helps (useful info) . Analyse your alignment . Interesting . links . Our Country . loads for a long time! . Our City . Our University . Our Institute . Our seminar . Our project . Name (optional) . Alignment . Nota Bene! .aln or .fasta format required!!! . Look here for comments . Tree (optional) . Nota Bene! Special scheme format required! . Look here for comments .

Еще в разделе: (Показать все результаты (>5445) - monkey.belozersky.msu.ru/ )

• SVETKA, a program for multiple sequence alignments analysis

... References . ... References to books should include the author's name; year of publication; title; page numbers where appropriate; publisher; place of publication, in the order given in the example below. ... Ramirez, F. J., Marquez, R. A. C., and Mondaca, G.: 1991, The 1877 great tsunami and the rapid local warning network in the coast of Northern Chile - South America, In: Proc. International Conference of Australian Earthquake Engineering Society , Brisbane, Australia, 25-1. ... Information . ...

Еще в разделе: (Показать все результаты (>20) - seac47-2.phys.msu.ru/ )

• Database search page

... Программа повышения квалификации ?Исследование природы вместе с детьми? ... День леса - 2013 . ... Содержание сборника, 2004 . ... из сборника Вместе со всей планетой , Пущино 1995 . ... Загадки и тайны мира природы очень интересны детям, даже самым маленьким. ... В 1995 г. мы вместе с учеными подмосковного города Пущино помогали школьникам выступить в роли экологических наставников для малышей . Заметка об этой работе была опубликована в журнале ЮНЕСКО Connect . ...

Еще в разделе: (Показать все результаты (>2) - kids.genebee.msu.ru/ )

Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Moscow, 2008 Acknowledgements A.Belinskiy M.Kornilov A.Tokovinin M.Kuznetsov P.Kortunov E.Gorbovskoy SAI administration some SAI students Pulkovo solar station (KHSS) staff RFBR support MAVEG Gmbh Why to study optical turbulence and some other relevant ... Mean seeing by DIMM data for this night is 1''5. ...

Еще в разделе: (Показать все результаты (>18) - curl.sai.msu.ru/ )

• atmos 3.0 page

... Конкурс У.М.Н.И.К. Объявления . ... Лучший молодой ученый года иљ . ... Конкурс научных работ молодых ученых МГУ (?Конкурс СМУ 2016?) Объявлен 40-й Конкурс научных работ молодых ученых МГУ, проводимый СМУ МГУ.љ ... 20 октября 2016 г. состоится полуфинальная конференция У.М.Н.И.К. 20 октября 2016 г. (ориентировочная дата) на Физическом факультете МГУ љ состоится полуфинальная конференция на получение премии поддержки молодых ученых У.М.Н.И.К. љ 20 октября 2016 г. состоится полуфинальный .. ...

Еще в разделе: (Показать все результаты (>4) - smu.physics.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

... MAX, MAX], MAX = 3'812'798'742'493. . ... MEMCAP - (read only) CSP - Control Stack Pointer - CSPL - CSP Low ­ CSP - CSP High ­ DSP - Data Stack Pointer - DSPL - DSP Low ­ DSP - DSP High ­ EXC - Exception ­ (0 ­ ) PC - Program Counter ­ STATUS - . ... EXC==-3) && (STATUS[IE]==1))) { pushcs(STATUS); // STATUS STATUS[IE]=0; // pushcs(PC); // PC PC = m(IVBASE + EXC); // EXC = 0; } else // { if (ICL == 1) // IC locked, IC ICL=0; else // { IC = m(PC); PC = PC+3; } } // IC PC execute; . ... STATUS. ...

Еще в разделе: (Показать все результаты (>2) - ternarycomp.cmc.msu.ru/ )

NEW ECONOMIC SCHOOL .. BSP/2007/094 R 2007 " " .. ... On The Dynamics of People's Unions / Working Paper # BSP/2007/094 R. - Moscow, New Economic School, 2007. - 19 p. (Rus.) ... Key words: public economics, allocation theory, size of nations ISBN ї .. ... x[0,1] - (FOC) FOC: (W1 (x) + W2 (1 - x)) = 0, x (1) - (SOC) SOC: 2 (W1 (x) + W2 (1 - x)) 0. x2 (2) , (1) (2), .. ... Grossman & Mendoza, 2001, 2004) , , , : , . ... On the Number and Size of Nations", Quarterly Journal of Economics Vol. ...

Еще в разделе: (Показать все результаты (>7) - belyakov.imec.msu.ru/ )

• Anton O. Belyakov

... site navigation | footer (site information) . IChO-2007 Participation Problems IChO RUSSIA Sponsors search . ... Moscow-1996 | ... Chemistry Department | ... Homepages of National Competitions Other International Science Olympiads Previous IChO's Miscellaneous Chemistry sites . ... Some fresh information is available. A letter from the President of 39th IChO . ... Information about post-Olympiad tour is now available . ... Information about guides of 39th IChO is now available. ...

179. http://studsov.math.msu.su/Sites/studsovet/Uploads/trendence_GBE_2011_-_About_the_survey.docs1.pdf

180. SPDC Laboratory | Department of Quantum Electronics