... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...

Еще в разделе: (Показать все результаты (>3) - siberian-lang.srcc.msu.ru/ )

. Welcome . Chronicles . Faculty today . Structure . Research . Collaboration . Admission . Useful Info . Academic Calendar . Grading System . Russian Language . Tuiton Structure . Postdoc . Fees . Contacts . Graduates !!! . Traditions . Campus Map . Faculty . Photogallery

Еще в разделе: (Показать все результаты (>23) - foroff.phys.msu.ru/ )

... Глава I. Корреляция электромагнитных полей в разнонаправленных модах.. ... I.1.1 Постановка задачи и идея эксперимента.. ... Влияние на двухфотонную интерференцию через форму рассеивающего объема .. ... Ш.1.1 Двухфотонная интерференция четвертого порядка (регистрация двумя детекторами).. ... IV.3 Двухфотонная интерференция в поле многомодовой накачки.. ... Глава V. Влияние на бифотонное поле в процессе распространения. ... V.3 Синтез состояний Белла .. ... V.3.2 Состояния Белла.. ... состояний Белла...

Еще в разделе: (Показать все результаты (>81) - qi.phys.msu.ru/ )

MODx encountered the following error while attempting to parse the requested resource: . PHP Parse Error . PHP error debug . Error: . mysql_connect() [ function.mysql-connect ]: Too many connections . Error type/ Nr.: ... home/biochem/biochem.bio.msu.ru/docs/manager/includes/extenders/dbapi.mysql.class.inc.php . Line: . ... Line 87 source: . ... mysql_pconnect($host, $uid, $pwd) : mysql_connect($host, $uid, $pwd, true))) { . Parser timing . ... PHP: . 0.0148 s . ...

Еще в разделе: (Показать все результаты (>4) - www.biochem.bio.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>24) - mouse.genebee.msu.ru/ )

... Environmentalist's Day in the Year of the Environment Two new national parks Meeting of the "Open Government" Expert Council New report on Russia's mineral resources The five-year plan of the Russian Ministry of Natural Resources The future of environmental management in Russia: Results of the Foresight Study Meeting of the UNESCO World Heritage Committee Eco-TV in Russia Eco-innovation in the context of green growth and sustainable development Environmentalists and "foreign agents" Editorial. ...

Еще в разделе: (Показать все результаты (>45) - eng.geogr.msu.ru/ )

• Recreational Geography and Tourism
• Vestnik MGU. Series 5. Geography
• Newsletter «RUSSIAN SUSTAINABILITY NewsLETTER»

... The given course consisting of lectures and seminars is aimed at teaching our students a whole range of measures, which allow quick and efficient faultfinding, functional testing, reliability testing of a device, find replacement for a faulty component at the modern technological level, fix a device, create a similar device even without the blueprints. ... Programming an unknown board on TestVue Software . ... Functional testing of an unknown board; comparison with the pattern . ...

Еще в разделе: (Показать все результаты (>23) - engineering.phys.msu.ru/ )

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>4) - sinp.msu.ru/ )

... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...

Еще в разделе: (Показать все результаты (>2) - vmu.phys.msu.ru/ )

Home Search Collections Journals About Contact us My IOPscience Garnet composite films with Au particles fabricated by repetitive formation for enhancement of Faraday effect This article has been downloaded from IOPscience. ... The thickness of a Bi : YIG composite film working for enhanced Faraday rotation was examined using an ion milling method. ... Figure 3(a ) shows the relationship between the total thickness of Au films and mean Au diameter for the repetitive formations using 5 and 2 nm films. ...

Еще в разделе: (Показать все результаты (>202) - nanolab.phys.msu.ru/ )

• User account | Laboratory of Nanophotonics & Metamaterials
• Contact vasyakov | Laboratory of Nanophotonics & Metamaterials
• User account | Лаборатория нанооптики и метаматериалов

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>5) - npidb.belozersky.msu.ru/ )

... Moscow State University, 119899, Moscow, Russia The results of experimental studies of the influence of substitutional disorder, doping impurities and of mutual influence of different off-center atoms on the ferroelectric phase transitions induced in IV-VI semiconductors by off-center atoms are reviewed. Keywords: phase transition, off-center ions, substitutional disorder, random fields, impurities . ... The example of such defects is off-center ions. ... Influence of doping impurities . ...

Еще в разделе: (Показать все результаты (>69) - scon155.phys.msu.su/ )

• Anomalous relaxation of light-induced states of a-Si:H
• Proceedings of the Fifth Russian-Japanese Symposium on Ferroelectricity
• First-principles calculations of physical properties of crystals

General Information . ... The conference is organized by the Sternberg Astronomical Institute (SAI) of Moscow University and the IAU Working group "Site-testing Instruments" . ... Use of site data in telescope operation and adaptive optics. ... Recent conferences on this subject (2007, 2008) demonstrated great interest of the community, hence the need for a new meeting. ... Unlike previous recent conferences, this meeting will cover all aspects of site monitoring for optical/IR astronomy. ...

Еще в разделе: (Показать все результаты (>22) - site2010.sai.msu.ru/ )

• Information

. Название публикации . The transversal stiffness of fibers and the desmin content in the leg muscles of rats under gravitational unloading of various duration . Авторы . Ogneva I. Дата . 31.12.2009 23:00:00 . Название журнала . J. Appl. Physiol. Купить нет на складе . 2009 ФФМ МГУ, 2009

Еще в разделе: (Показать все результаты (>8) - fbm.msu.ru/ )

... I would like to invite you to visit my website http://www.againstchance.webs.com/ where I present the demonstration of my invention, the device for predicting the Future. It is a computer program which reveals the reaction of the computer to the future creation of a file, and since the command to create a file can be given to the computer in accordance with the outcome of any external event, such a reaction can predict that event, too. ...

Еще в разделе: (Показать все результаты (>18) - temporology.bio.msu.ru/ )

• A FREGIMO AMISSA - Научный адъ

... Описание вакансии: . The Famous FMCG Company (Top-3) looks for Standards Office Manager in R Department . ... Create and register R and Regulatory documentation . ... Manage update of documentation in valid forms. Daily tracking of documentation validity and make changes in proper time to ensure the correct and on time activity of commercial production. ... Fluent English and excellent computer skills, skills to work with the databases . High skills to work with people; teamwork skills . ...

Еще в разделе: (Показать все результаты (>25) - www.chemport.ru/ )

• "R@d manager" - вакансия в разделе "Работа для химиков" @ChemPort.Ru
• "Head of chemistry" - вакансия в разделе "Работа для химиков" @ChemPort.Ru

Вход в личный кабинет . ... Ярмарка вакансий и стажировок для студентов и выпускников вузов . Новости науки и техники События . ... Подписаться на новости . Вакансии . ... Компания: Nielsen company . The Nielsen Company is a market-leading information & media company with more than 41,000 employees in 100+ countries around the world. ... Please send your CV before June 9th marked in Subject line Summer Internship Program at: RussiaMoscow.HR@nielsen.com or info.russia@nielsen.com . ...

Еще в разделе: (Показать все результаты (>77) - www.physcareer.ru/ )

• ЗАО КБ 'Ситибанк' ПРИГЛАШАЕТ НА РАБОТУ / Вакансии / Physcareer.ru

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

Moscow Astronomical Plate Archives: . Contents, Digitization, Current and Possible Applications . ... We describe the astronomical plate archives in Moscow and Zvenigorod and the existing digitization projects. ... 2 The Plate Archive of the Sternberg Institute . The contents of the most important Moscow astronomical plate archive, that of the Sternberg Astronomical Institute, was briefly presented in Shugarov et al. [1] in 1999. ... THE MOSCOW PLATE COLLECTION (STERNBERG INSTITUTE) . ...

Еще в разделе: (Показать все результаты (>21) - www.sai.msu.ru/ )

Experimentation and Personality , 1 Explicating the Black Box through Experimentation : Studies of Individual Differences and Cognitive Processes Howard Lavine Department of Political Science, SUNY ­ Stony Brook Stony Brook, NY 11794-4392 Howard.Lavine@sunysb.edu Corresponding Author Milton Lodge Department of Political Science, SUNY ­ Stony Brook Stony Brook, NY 11794-4392 Milton.Lodge@sunysb.edu James Polichak School of Law, University of Michigan ... The Authoritarian Personality. ...

Еще в разделе: (Показать все результаты (>17) - suny.msu.ru/ )

• Центр по делам России и США :: Публикации