My colleagues and I have recently completed a series of observations of SN1999an. ... The telescope is located at Martin Observatory in Blacksburg, VA, and is operated by the Physics Department of Virginia Tech. Our IAU Minor Planet Center Observatory Code is 841. ... Attached you will find a copy of one of our images (in .jpg format) with the supernova indicated. ... Virginia Tech Department of Physics . Back to Bright Supernovae . Back to Supernova 1999an . ...

Еще в разделе: (Показать все результаты (>3) - www.rochesterastronomy.org/ )

Автор: Елена Демидова . Опубликовано: August 16, 2010, 5:56 pm . Московский городской психолого-педагогический университет ( МГППУ ) . ... Адрес: Москва, ул. Сретенка, 29 , ауд.506 . ... Москва, 23 сентября 2008 г. Факультет психологического консультирования МГППУ - Профессиональная переподготовка | Москва . ... Клиент-центрированная психотерапия и личностно-ориентированный подход | ... Флогистон / новости психологии / Клиент-центрированная психотерапия и личностно-ориентированный подход | ...

Еще в разделе: (Показать все результаты (>4) - www.flogiston.ru/ )

... О факультете . ... Master In Ecology . ... Master (MSc) . ... A Master will be able to successfully deal with conceptual issues and practical problems related to various subflields of ecology and environmental science. ... Enables the students to develop biopolicies to deal with ecological problems caused by environmental pollution, the disruption of the ecological matrix of an area, and biodiversity-endangering factors. ... Lectures . ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ ...

Еще в разделе: (Показать все результаты (>4) - www.bio.msu.ru/ )

MATSYM - symbolic matrix processor . ... To use the program you will need a MAT file (liked CIR file: "User manual for CIRSYM program") of your system. ... In first string of MAT file enter any text you want to be the title of your system. ... Starting from string 2 (if is not comments - "*") enter the system element name, incident row and column and, optionally, its value. ... To generate a solution, run MATSYM.exe and enter "system_file_name.CIR" or click on the "ENTER" (in "MAT" case). ...

Еще в разделе: (Показать все результаты (>6) - astrometric.sai.msu.ru/ )

• Symbolic circuit processor
• Specification

... Scientific goals . ... Automatic gaze stabilization corrector . Scientific equipment . ... IMISS-1 . ... Comparing the measured and calculated values we?ll find out if it is possible to use microelectromechanical inertial measuring modules in an automatic gaze stabilization corrector , and calculate the value of changes of microsensors? instrumental errors under the space conditions as against the Earth ones. ...

Еще в разделе: (Показать все результаты (>6) - lomonosov.sinp.msu.ru/ )

... Форумы > Аспирантура > Тема . ... PhD position in the University of Florida . PhD position is available in the department of Industrial and Systems Engineering, University of Florida. ... Risk Management and Financial Engineering Lab website: http://www.ise.ufl.edu/rmfe/ . ... Statistical estimation in terms of factor models can be tuned to risk preferences in order to achieve better performance when applied to portfolio optimization. ... University of Florida, November 2011. ...

Еще в разделе: (Показать все результаты (>64) - www.mmonline.ru/ )

• MMOnline | Форумы | Разное | Требуется Web - дизайнер.

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• StructAlign help

... In contrast to the approach developed in [7], which is based on a differential operator, here a pseudo-differential, i.e., a non-local operator is applied to the wave field. Using this non-local operator a new embedding formula is derived for scattering by a single wedge. ... Using the integral formula for Bessel functions represent the function v as a linear combination of plane waves: v (r, ) = J (k0 r)ei = 1 2 e ik0 r cos( -) i ( - /2) e d (35) where contour is shown in Fig. ...

Еще в разделе: (Показать все результаты (>48) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/gusev_files/nano2.pdf
• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/grating5.pdf
• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/prsla02.pdf

... We present some results of new calculations of D" ( t ) the second derivative of the Moon's elongation as a function of time. ... Let X be a set of all preserved recordings of observations of ancient Sun and Moon eclipses (see the list in [ 2 ], pp. 167 271): let A be a set of eclipses described in X (any eclipse a A may have some records corresponding to it and form X ( a )). ... The recount of dates t ( a 0 ), a 0 A ,( 700) < t ( a 0 ) < (+400), was first made by N. A. Morosov. ...

Еще в разделе: (Показать все результаты (>83) - hbar.phys.msu.ru/ )

• Замечание Михаила Городецкого
• Фоменкология
• Critical remarks

... О кафедре . ... КРИВОНОЖКО Владимир Егорович (11.06.1948, г. Москва) д.физ.-мат.н., профессор МФТИ, зав. кафедры АСУ МИСИС. ... Krivonozhko V. E., F rsund F. R. Lychev A. V. Terminal units in DEA: Definition and Determination // University of Oslo. ... F rsund F. R., Krivonozhko V. E., Lychev A. V. Hidden Effects in DEA Models //Differential Equations. ... Krivonozhko V. E., F rsund F. R., Lychev A. V. Some Ulterior Effects in the DEA models // Abstracts of the INFORMS Annual Meeting. ...

Еще в разделе: (Показать все результаты (>4) - ndsipu.cmc.msu.ru/ )

• Моделирование и анализ функционирования сложных систем | Кафедра НДСиПУ

... Giant Second Harmonic Generation in Microcavities Based on Porous Silicon Photonic Crystals T. V. Dolgova1, A. I. Maoedikovskioe1, M. G. Martem'yanov1, G. Marovsky2, G. Mattei3, D. Schuhmacher2, V. A. Yakovlev4 ... Academy of Sciences, Troitsk, Moscow region, 142092 Russia Received November 28, 2000 1 4 The experimental spectral dependence of the intensity of the second harmonic (SH) generated in microcavities based on porous silicon ...

Еще в разделе: (Показать все результаты (>20) - shg.phys.msu.ru/ )

• http://shg.phys.msu.ru/ruscon/articles/pdf/96_PhysRevB_54.pdf
• http://shg.phys.msu.ru/ruscon/articles/pdf/04_JETP98_THG.pdf
• http://shg.phys.msu.ru/ruscon/articles/pdf/99_PhysRevB_60.pdf

arxiv:1008.3999 Наблюдения космических электронов на Fermi LAT на энергиях от 7 ГэВ до 1 ТэВ (Fermi LAT observations of cosmic-ray electrons from 7 GeV to 1 TeV) . Authors: Fermi LAT collaboration . ... Authors: Andrey E. Vladimirov et al. обзор arxiv:1008.5032 Релятивистская прецессия спина в двойных пульсарах (Relativistic spin-precession in binary pulsars) . Authors: Michael Kramer . ... обзор arxiv:1008.2144 Массивные звезды и их сверхновые (Massive Stars and their Supernovae) . ...

Еще в разделе: (Показать все результаты (>107) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/2002-07_2003_03/mhd.html
• Новости науки

. КОМПЬЮТЕРЫ . Решение астрономической задачи N тел на кластере из ГПУ (pdf) . Exploring weak scalability for FEM calculations on a GPU-enhanced cluster (pdf) . Using GPUs to Improve Multigrid Solver Performance on a Cluster (pdf) . ClawHMMER: A Streaming HMMer-Search Implementation (pdf) . Проект Folding@Home . Лаборатория Параллельных информационных технологий НИВЦ МГУ .

174. http://master.sai.msu.ru/media/presentations/2014/20140208_Shibata.pdf

175. NPIDB: Interaction

176. БЧА НИВЦ МГУ. SF51R_C. Специальные функции математической статистики

177. EUROMECH Colloquium-458

178. http://curl.sai.msu.ru/mass/download/doc/dimm_specs.pdf

179. http://math.phys.msu.ru/data/283/Programme_13th_Workshop.pdf

180. http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc