... education . research . ... Fundamentals of Nanotechnology . ... Molecular physiology . ... Pass/fall exam: 5 p.m., 22 May, 2009 (those third-year students who pass the exam undertake further study majoring in Nanosystems and Nanodevices , Functional Nanomaterials , Nanobiomaterials and Nanobiotechnology). ... 10 February 2009 . ... Prof. Yu. ... Work of molecular motors: ATP synthetase, photosynthetic reaction centers, retinal containing photosensitive proteins (rhodopsin, bacteriorhodopsin.) ...

Еще в разделе: (Показать все результаты (>29) - nano.msu.ru/ )

• Fundamentals of Nanotechnology, 2009 | Научно-образовательный центр по
• MSU Nanotechnology Education and Research Center. Mission. | MSU Nanotechnology
• Forthcoming seminars. Condensed Matter Physics | MSU Nanotechnology Education

... Advanced chapters of operation research . Algebraic characterization of basic solution of linear program. ... Advanced chapters of Actuarial Mathematics . ... Discounted cash flow analysis and capital budgeting as decision tools are given particular emphasis. ... In the first part of the course we present a modern approach to modeling economic systems. ... The problem of tax optimization under a given financing budget. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>14) - hcs.cmc.msu.ru/ )

... We designed a prototype of a direction-sensitive optical mo dule (DOM) and we accordingly mo dified the simulation and reconstruction codes [2] currently used by the ANTARES Collaboration to study the response of the detector. The DOM is based on a position-sensitive photomultiplier coupled to a light guide system such that all the Cherenkov light arriving from the same direction is fo cussed on a reduced area of the photo catho de. ... Left: standard optical module; right: DOM. ...

Еще в разделе: (Показать все результаты (>26) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/INFN%20-%20NEMO.pdf
• http://antares.sinp.msu.ru/docs/Shirokov%20-%20The%20first%20results%20of%20MSU%20groups%20in%20ANTARES%20project.pdf
• ANTARES в МГУ

Psychology in Russia: State of the Art Volume 6, Issue 3, 2013 Russian Psychological Society Lomonosov Moscow State University SPECIAL SECTION: "SCIENCE IN DIALO GUE" -- 10th SINO-GERMAN WORKSHOP SELECTED PAPERS unasked questions and unused answers in psychology Ernst PЖppel a,b,c, Yan Bao ,a,b, Shihui Han ,a, Alexey A. Sozinov d, Dmitry V. Ushakov d, Artem I. Kovalev e, Alexander M. Chernorizov e, Galina Ya. ... Experimental Brain Research, 68, 445­448. doi: 10.1007/BF00248813 PЖppel, E. (1989). ...

Еще в разделе: (Показать все результаты (>157) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/science/psyrussia/2012/bolotova.pdf
• http://www.psy.msu.ru/science/psyrussia/2013-3/2013_3_41-48.pdf
• http://www.psy.msu.ru/science/psyrussia/2012/belova.pdf

. Strict Standards : Only variables should be assigned by reference in /storage0/www/http/fengoffice/environment/classes/debug/BenchmarkTimer.class.php on line 273 . Strict Standards : Only variables should be assigned by reference in /storage0/www/http/fengoffice/environment/classes/debug/BenchmarkTimer.class.php on line 297 . Забыли пароль . E-mail адрес: . Выслать пароль ( Вход ) .

Еще в разделе: (Показать все результаты (>2) - aesc.msu.ru/ )

. [Russian] .. Education, . Research Interest . Scientific Achievements . My Teachers . Parachute Science . Parachute Equipment . Margarita Dzhalalova . Ph.D. (Phys.& Math.), Senior Research Scientist . Address: . Institute of Mechanics . M.V. Lomonosov Moscow State University . 1 Michurinsky pr. Moscow 119192, Russia . E-mail: . margarita-vd@mail.ru . Copyright & Design 2001 by M. Dzhalalova . М.B. Джалалова

Еще в разделе: (Показать все результаты (>7) - margaret.imec.msu.ru/ )

• On Square Parachute Differential Equations
• Large-Scale Load Stabilization

... MIT OpenCourseWare (бесплатные учебные курсы Massachusetts Institute of Technology ) . ... UCSB CS140 - Parallel Scientific Computing: Winter 2007 . ... Scientific Computing for Engineers (Prof. Jack Dongarra, Department of Computer Science (CS) at the University of Tennessee, Knoxville) . Introduction to Finite Element Methods (ASEN 5007) Fall 2007 (Department of Aerospace Engineering Sciences, University of Colorado at Boulder) . ...

Еще в разделе: (Показать все результаты (>5) - ani.cs.msu.su/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• Comparison of protein phylogeny reconstruction methods
• Nhunt: program for nucleic acid sequence similarity search

... June 9, 1999 . NGC 4414: A Telling Spiral . ... the Hubble Heritage Team ( AURA / STScI / NASA ) . Explanation: How far away is this galaxy? ... Spiral galaxy NGC 4414 contains many Cepheid variable stars that oscillate in a way that allows astronomers to estimate their distance. ... NGC 4414 shows many classic spiral galaxy features, including thick dust lanes , a central region rich in old red stars, and winding spiral arms glowing with young blue stars. ... About APOD > . ...

Еще в разделе: (Показать все результаты (>27) - www.arcetri.astro.it/ )

• APOD: 2000 November 28 - BZ Cam Bow Shock
• APOD: 2000 July 13 - LP 944-20: A Failed Star Flares

... Education in the Department starts on the third course. ... The large practical course lasts for 2 years and consists of several parts. ... This project is performed either at the Department of Biochemistry or in the friendly laboratories of the Institute of Physicochemical biology of the Moscow State University, in the Russian Cardiology Centre, in the Institute of Biochemistry or in the Institute of Bioorganic Chemistry of Russian Academy of Sciences and many other scientific institutions of...

Еще в разделе: (Показать все результаты (>78) - biochem.bio.msu.ru/ )

• Biochemistry Department of Moscow State University | Regulation of muscle
• Biochemical characterization of small heat shock protein HspB8 (Hsp22)-Bag3
• Biochemistry Department of Moscow State University | History

... Полная версия этой страницы: ZFC IS INCONSISTENT. Студенческий форум Физфака МГУ > Наука физика > Проверка теорий на прочность . ... Models the assumption, that set of all formulas of any theory . ... 2) Existence of set Y certain by means of formula F (x), together . with axioms ZFC.(3) (x$Y) it is demonstrable in ZFC. ... Let's assume, that the set of all ZFC-formulas can be considered as . usual ZFC-set. ... existence is demonstrable set W which elements will be all ZFC- . ...

Еще в разделе: (Показать все результаты (>356) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > PhD positions in Switzerland
• Студенческий форум Физфака МГУ > Помогите скачать статью IEEE
• Студенческий форум Физфака МГУ > Влияние космических лучей на климат

... Home . ... Board of directors . About the project . ... Read more . ... Project director . ... PhD, Research Associate . Director of the scientific part of the project . ... PhD, Deputy Vice-Rector . Technical Coordinator . ... Project coordinator . ... Coordinator of "Biological information" part of the project . ... Coordinator of "Human biomaterial" part of the project . ... Coordinator of "Animals" part of the project . ... Coordinator of "Plants" part of the project . ...

Еще в разделе: (Показать все результаты (>2) - depository.msu.ru/ )

... PhD student needed in the Institute of Physical Chemistry in Warsaw, Poland for a study involving mostly calculations and NMR measurements of strained hydrocarbons with unusual spatial structure. ... As can be seen in the webpage, the group is also involved in studies in supramolecular chemistry and, if interested, the student could also take part in this research. ... The entrance exam is based on "Physical Chemistry" by Atkins. ...

Еще в разделе: (Показать все результаты (>37) - www.chemport.ru/ )

• "PhD in France" - вакансия в разделе "Работа для химиков" @ChemPort.Ru

... TYPE: COM PAGN: Murthy.N -- SCAN: Profi Physica E 000 (2001) 000­000 www.elsevier.com/locate/physe 1 3 Electron spectrum and infrared transitions in semiconductor superlattices with a unit cell allowing for quasi-localised carrier states A.V. Dmitrieva ; , R. Keiperb , V.V. Makeeva a 5 7 Department of Low Temperature Physics, Faculty of Physics, Moscow State University, Moscow, 119899, Russia b Institut fur Physik, Humboldt­Universitat zu Berlin, Invalidenstr. ... Let us call this subband resonant. ...

Еще в разделе: (Показать все результаты (>16) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/physE-2001.ps.gz
• http://lizard.phys.msu.su/home/science/jap-06.pdf
• http://lizard.phys.msu.su/home/science/Dmitriev-Ivanov-Xoxlov-09-FPM-Diffuser.pdf

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>160) - www.pereplet.ru/ )

... BMC Genomics 2013, 14:476 http://www.biomedcentral.com/1471-2164/14/476 RESEARCH ARTICLE Open Access The miniature genome of a carnivorous plant Genlisea aurea contains a low number of genes and short non-coding sequences Evgeny V Leushkin1,2, Roman A Sutormin1, Elena R Nabieva1, Aleksey A Penin and Maria D Logacheva1,5* 1,2,3 , Alexey S Kondrashov 1,4 Abstract Background: Genlisea aurea (Lentibulariaceae) is a carnivorous ... Second, loss of genes could be involved. ... Plant Biol. ...

Еще в разделе: (Показать все результаты (>9) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/batmas30.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/bmc_genom2_2013.pdf

Non-KЁ ahler complex structures on moment-angle manifolds and other toric spaces Taras Panov joint with Yuri Ustinovsky Moscow State University Several Complex Variables Steklov Institute, Moscow, 27 February­3 March 2012 1. ... Now assume K is the underlying complex of a complete simplicial fan (a starshap ed sphere). ... A fan = {1, . ... Manifolds ZK corresp onding to complete regular simplicial fans are total spaces of holomorphic principal bundles over toric varieties with fibre a complex torus. ...

Еще в разделе: (Показать все результаты (>135) - higeom.math.msu.su/ )

• C*-algebras: Talks
• Conferences (English)
• Mishchenko Alexandr S.

... J.K. Krylov . In the monography by R. Koehler [1] there was described a very interesting effect of the words' average length oscillation as a function of their frequency of use (according to the data from a representative frequency dictionary). ... In this context, further the Koehler's effect will be definied as polymodal character of the dependence of the conditioned average in cases of two-dimencional distributions of any linguistic nature. ...

Еще в разделе: (Показать все результаты (>52) - old.philol.msu.ru/ )

• Basic Assumptions about a Sign's Life Cycle for Mathematical Modelling of
• Khmelev D.V.- Disputed Authorship Resolution Using Relative Empirical Entropy
• MSU-LGCLL:: DicTUM-1 - A System for Dictionary-Text Universal Manipulations and

... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...

Еще в разделе: (Показать все результаты (>2) - composite.msu.ru/ )

... Information for the applicants . ... News . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Faculty of Bioengineering and Bioinformatics, office 433. ... 2016 Faculty of Bioengineering and Bioinformatics, . Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>3) - en.fbb.msu.ru/ )

• Background? Faculty of Bioengineering and Bioinformatics, MSU