... Executing config_lcgenv Executing config_java Executing config_ glite _tar_ui gLite Security Utilities configuration successfully completed xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Configuring the gLite R-GMA Client xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Checking configuration values [ OK ] Verifying the / gLite / glite / etc ... Configuring BDII based Service Discovery [ OK ] Configuring R-GMA based Service Discovery .. ...

Еще в разделе: (Показать все результаты (>5) - lhe.sinp.msu.ru/ )

• LHPR Homepage

ft ra D DAYS on DIFFRACTION 2012 1 Theory of selfrefraction effect of intensive fo cused acoustical b eams V.A. Gusev Lomonosov's Moscow State University, Physical Faculty, Department of Acoustics, Russia, 119991, Moscow, Leninskie gori; e-mail: vgusev@bk.ru The theory of selfrefraction of nonlinear acoustical beams is developed based on some exact and approximate analytical equations and solutions. ... What is the main factor limiting the pressure in the focus -- diffraction or selfrefraction? ...

Еще в разделе: (Показать все результаты (>44) - acoustics.phys.msu.ru/ )

The Laboratory of the Historical Information Science . ... The historical information science laboratory was founded within the structure of the source studies department on 8 December 1995 for the purpose of fulfilling the decision of the academic council of the History Faculty of 4 October 1991 about the transformation of a group for the application of mathematic methods and mainframes in historical research in the laboratory of historical information sciences. ... Senior laboratory assistant (2) . ...

Еще в разделе: (Показать все результаты (>367) - www.hist.msu.ru/ )

• Editions

arxiv:1006.2463 Семилетний обзор неба в жестком рентгене по данным INTEGRAL/IBIS. ... Part I: Image Reconstruction) . ... arxiv:1006.3070 Прямое изображение планеты у молодой звезды типа Солнца 1RXS J160929.1-210524: подтверждение общего собственного движения, температуры и массы (The Directly Imaged Planet around the Young Solar Analog 1RXS J160929.1-210524: Confirmation of Common Proper Motion, Temperature and Mass) . ... обзор arxiv:1006.5394 Теория образования галактик (Galaxy Formation Theory) . ...

Еще в разделе: (Показать все результаты (>486) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/1512.html
• http://xray.sai.msu.ru/~polar/sci_rev/0701.html
• Новости науки

HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММ?И ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, © м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...

Еще в разделе: (Показать все результаты (>32) - cryst.geol.msu.ru/ )

Statistics in Morse theory of smo oth functions Vladimir I. Arnold Steklov Mathematical Institute, Moscow, Russia e-mail: arnold@mi.ras.ru There are exactly 17746 topologically distinct Morse functions with 4 saddles on the two dimensional sphere. This result basing on combinatorics of random graphs was obtained only two years ago within an investigation of Hilbert's 16th problem on topological classification of polynomials in real algebraic geometry. ...

Еще в разделе: (Показать все результаты (>20) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/Kozlov.pdf
• http://pont2008.cs.msu.ru/files/en/abstracts/Zakalyukin.pdf
• Program Международная конференция Дифференциальные уравнения и топология ,

Chair for Solid State Physics of the Department of General and Applied Physics (FOPF) of Moscow Institute for Physics and Technology is based in Chernogolovka, at the Institute for Solid State Physics since early 1960-ies. The high quality of scientific researches performed in the ISSP is mostly due to thorough and industrious training of scientific personnel. Leading scientists of the Institute deliver lectures and provide practical training for the students. ... MIPT's Page of the Chair . ...

Еще в разделе: (Показать все результаты (>23) - www.issp.ac.ru/ )

• Filial of Chair of MISiS in ISSP, Chernogolvka
• Mirrow of main window SAO RAS
• IO of EAAS, Problems to solve (In Russian)

... 86, No. 12, pp. 1163ґ1178. i Structure of the Galaxies of the NGC 80 Group : Two-Tiered Disks M. A. Startseva1 , O. K. Sil'chenko1 , and A. V. Moiseev 1 2 Sternberg Astronomical Institute, Moscow State University, Moscow, ... photometric data obtained on the 6-m telescope of the Special Astrophysical Observatory are used to analyze the structure of 13 large disk galaxies in the NGC 80 group ... All the large lenticular galaxies have two-tiered exponential disks and exponential Є...

Еще в разделе: (Показать все результаты (>49) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/ilyina_sil.pdf
• http://sn.sai.msu.ru/~sil/preprints/al75.pdf
• http://sn.sai.msu.ru/~sil/preprints/uvrings.pdf

Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...

Еще в разделе: (Показать все результаты (>34) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации
• Process of Forming a Company - Discussion Question

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• ConClus

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: ?аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>62) - ecfs.msu.ru/ )

• Draft Plan of Action for Eurasian Subregional Partnership | ECFS

НЕЛИНЕЙНЫЕ ВОЛНЫ В ДНК. АНАЛИТИЧЕСКИЕ ИССЛЕДОВАНИЯ И КОМПЬЮТЕРНОЕ МОДЕЛИРОВАНИЕ . ... Обсуждаются и сравниваются результаты аналитических исследований и компьютерного моделирования нелинейных конформационных волн в ДНК. ... Показано, что с помощью компьютерных методов удается получить новые нелинейные волновые решения, которые не удавалось получить аналитическими методами. ... These waves are the solutions of the equations describing large-amplitude rotational motions of DNA bases. ...

Еще в разделе: (Показать все результаты (>22) - www.library.biophys.msu.ru/ )

• ФИЗИЧЕСКИЕ ПОДХОДЫ В ИССЛЕДОВАНИЯХ ДНК

Design of Micrometeoroid/Orbital Debris Impact Shield and Development of Failure Risk Assessment System for Orbital Spacecraft N.G. Chechenin Skobeltsyn Institute of Nuclear Physics Lomonosov Moscow State University Space Debris Growth http://www.nasa.gov/pdf/582393main_OCT-Orbital_ Debris _TAGGED.pdf January 19, 2015 China-Russia Joint Space Science Project Proposals Workshop 2 Space ... Crater formation January 19, 2015 Craters on metal surface from meteoroid particle. ...

Еще в разделе: (Показать все результаты (>105) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/Seminars_Pdf-filesPresentations/Chechenin_Presentation_14-01-16.pdf
• http://danp.sinp.msu.ru/pci2015/utro_stend_28.pdf

Ботанический сад МГУ участвует в новом проекте Европейского союза 'INQUIRE', который направлен на развитие интереса к науке у школьников и широкое внедрение в образовательные системы европейских стран (общего и дополнительного образования) новых образовательных технологий и методов обучения (IBSE), основанных на развитии внеклассной научной проектно-исследовательской деятельности школьников (LOC- Learning Outside the Classroom). ... Ботанический сад Московского государственного университета (Россия) . ...

Еще в разделе: (Показать все результаты (>15) - botsad.msu.ru/ )

... to Composite Mechanics Chair. was based at Mechanical & Mathematical Department in 1987. ... Address: Composite Mechanics Chair, Mechanical & Mathematical Department, Moscow State University, Moscow 119899, Russia. ... The Department of the Composites Mechanics was found at the Faculty of Mechanics and Mathematics of Lomonosov Moscow State University (MSU) in 1987. ... Optimisation of numerical methods in Solid Mechanics . Application of asymptotical methods in Composites Mechanics . ...

Еще в разделе: (Показать все результаты (>3) - composite.msu.ru/ )

Индикаторы качества местообитаний и показатели "состояния" сообществ беспозвоночных. ... Петрозаводск, 2001, 3-7 сент., ... Для лесных ландшафтов выбраны следующие группы: Macrolepidoptera (фитофаги), наземные моллюски (потребители опада), древесные жуки (древоточцы); для травяных местообитаний пчелы (опылители), почвообитающие жуки (главным образм, хищники) и журчалки, божьи коровки и златоглазки (афидофаги). Для оценки состояния лесных экосистем весьма перспективны ночные Macrolepidoptera. ...

Еще в разделе: (Показать все результаты (>25) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=5&subtheme=22&from=&ref_ind=0412002142
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=15&from=&ref_ind=0218004195
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=7&subtheme=31&from=&ref_ind=0209000187

Sum of Squares of polynomials technique for stability and bounds in fluid dynamics S. Chernyshenko (Imperial College London) and P. Goulart (ETH Zurich) This talk will introduce a new method for proving global stability of fluid flows using recently developed optimization methods based on sum-of- squares (SOS) decomposition to construct a polynomial Lyapunov function. ... Such polynomial functions can be searched for efficiently using the SOS technique. ...

Еще в разделе: (Показать все результаты (>20) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2006/CD/BozhkoAAPutinGF.doc
• http://hit-conf.imec.msu.ru/2006/CD/BozhkoAAPutinGF.pdf

... K. Potzger, "Ion beam based doping and defects for tailoring magnetic properties", PNI workshop "Magnetism and highly correlated electron systems", 11.6.- ... M. Butterling, W. Anwand, S. Cornelius, K. Potzger, A. Smekhova, M. Vinnichenko, A.Wagner, "Investigations of defects in magnetic TiO2 using a slow-positron-beam", Abstract Book of the 16th International Conference on Positron Annihilation (ICPA16), University of Bristol, United Kingdom, 19-24 August 2012, p.150 (2012) 3. ... 7540-7544 (2012)...

Еще в разделе: (Показать все результаты (>20) - magn.phys.msu.ru/ )

• http://magn115.phys.msu.ru/Rus/DETI2/smekhova.html

... This applet generates an observing list based on an observer's location and time. ... To use this program, enter in your location, and the local times at which you wish to begin and end observing. The date you enter should correspond to the calendar day at the time at which you begin observing. For example, if you wish to observe from 9:37 PM October 23, 2007 until 3:21 AM October 24, 2007, you would enter 21:37 for the starting time, 03:21 for the finish time, and 10/23/2007 for the date. ...

Еще в разделе: (Показать все результаты (>34) - observ.pereplet.ru/ )

• MASTER GLOBAL ROBOTIC TELESCOPES NET

... Fast Facts about the Faculty of Journalism . ... Academic . ... Academic Departments . ... Partners . ... All partners . ... Academic Options . ... The Department of Journalism offers Bachelor , Master or PhD degree in journalism and mass communications. ... Completing a Bachelor s degree programme in the Department of Journalism gives you a broad view of the media system and allows you to enter the journalism world with all the skills needed to be a professional. ... History of Journalism . ...

Еще в разделе: (Показать все результаты (>68) - www.journ.msu.ru/ )

• The Second International Media Readings in Moscow
• The Second International Media Readings in Moscow :: Факультет журналистики МГУ
• The Two Dean?s Cup :: Department of Journalism, M. V. Lomonosov Moscow State