... Рассказ о факультете . ... Семинар "MSU and EF Research Collaboration Enhancing Language Learning and Teaching" . 1 октября на факультете состоялся научно-практический семинар "MSU and EF Research Collaboration Enhancing Language Learning and Teaching". ... Dr. Bernard Shearer, Head of English First in Russia (based in Moscow): Overview of English First and discussion of the different initiatives for teaching a variety of populations (young learners, teenagers, government, Olympics, etc.) ...

Еще в разделе: (Показать все результаты (>184) - ffl.msu.ru/ )

• About Us

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• ConClus

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>40) - observ.pereplet.ru/ )

• Candidate Assignments

... Институт . ... Студентам . Приветствуем вас на Официальном сайте Русско-германского института науки и культуры. Published by admin on April 6, 2016 under Новости . ... No Comments ? ... 09.00 - 15.30 љ љљ 736 - 1.ГУМ . ... Морозова Е.Б. пн. љ17-00? 18-30, 18-45?20-15, 20-30?21-15љ 1 к., ауд.736 1 ГУМ . ... Башкиров В. М. вторник 15.00-17.00, четверг љ15.00-17.00, 1 ГУМ ауд.736 . вторник 17.00-19.00, пятница 17.00-19.00 1 ГУМ ауд.736 . ... 736 1 Гум) . ... 7361 Гум) . ... December 2011 . ...

Еще в разделе: (Показать все результаты (>2) - rgi.msu.ru/ )

... Anatoliy A.Polikarpov . ... Basing on the assumption of basic semantic micro- processes do minating in the history of any word meaning is possible to predict [Polikarpov, 1988; 1990; 1991; 1993; 1994; 1995] and to test ... Kapitan, 1994; Breiter, 1994; Breiter, Polikarpov, 1997; Savchuk, 1997] some most probable directions for the derivative micro- processes (e.g., change of some semasiological and word-formational parameters of a word) and for macro- evolution of a ...

Еще в разделе: (Показать все результаты (>61) - old.philol.msu.ru/ )

• Melnikov G.P.- Systemology and Linguistic Aspects of Cybernetics
• Dmitry V. Khmelev: List of Publications
• HumLang: Polikarpov A.A.- Menzerath's Law for Morphemic Structures of Words:A

Ботанический сад МГУ участвует в новом проекте Европейского союза 'INQUIRE', который направлен на развитие интереса к науке у школьников и широкое внедрение в образовательные системы европейских стран (общего и дополнительного образования) новых образовательных технологий и методов обучения (IBSE), основанных на развитии внеклассной научной проектно-исследовательской деятельности школьников (LOC- Learning Outside the Classroom). ... Ботанический сад Московского государственного университета (Россия) . ...

Еще в разделе: (Показать все результаты (>15) - botsad.msu.ru/ )

... to Composite Mechanics Chair. was based at Mechanical & Mathematical Department in 1987. ... Address: Composite Mechanics Chair, Mechanical & Mathematical Department, Moscow State University, Moscow 119899, Russia. ... The Department of the Composites Mechanics was found at the Faculty of Mechanics and Mathematics of Lomonosov Moscow State University (MSU) in 1987. ... Optimisation of numerical methods in Solid Mechanics . Application of asymptotical methods in Composites Mechanics . ...

Еще в разделе: (Показать все результаты (>3) - composite.msu.ru/ )

• INTAS 95-525 Final Reprort (Short version)

Индикаторы качества местообитаний и показатели "состояния" сообществ беспозвоночных. ... Петрозаводск, 2001, 3-7 сент., ... Для лесных ландшафтов выбраны следующие группы: Macrolepidoptera (фитофаги), наземные моллюски (потребители опада), древесные жуки (древоточцы); для травяных местообитаний пчелы (опылители), почвообитающие жуки (главным образм, хищники) и журчалки, божьи коровки и златоглазки (афидофаги). Для оценки состояния лесных экосистем весьма перспективны ночные Macrolepidoptera. ...

Еще в разделе: (Показать все результаты (>15) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=5&subtheme=22&from=&ref_ind=0412002142
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=15&from=&ref_ind=0218004195
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=7&subtheme=31&from=&ref_ind=0209000187

Sum of Squares of polynomials technique for stability and bounds in fluid dynamics S. Chernyshenko (Imperial College London) and P. Goulart (ETH Zurich) This talk will introduce a new method for proving global stability of fluid flows using recently developed optimization methods based on sum-of- squares (SOS) decomposition to construct a polynomial Lyapunov function. ... Such polynomial functions can be searched for efficiently using the SOS technique. ...

Еще в разделе: (Показать все результаты (>15) - hit-conf.imec.msu.ru/ )

... K. Potzger, "Ion beam based doping and defects for tailoring magnetic properties", PNI workshop "Magnetism and highly correlated electron systems", 11.6.- ... M. Butterling, W. Anwand, S. Cornelius, K. Potzger, A. Smekhova, M. Vinnichenko, A.Wagner, "Investigations of defects in magnetic TiO2 using a slow-positron-beam", Abstract Book of the 16th International Conference on Positron Annihilation (ICPA16), University of Bristol, United Kingdom, 19-24 August 2012, p.150 (2012) 3. ... 7540-7544 (2012)...

Еще в разделе: (Показать все результаты (>21) - magn.phys.msu.ru/ )

• http://magn115.phys.msu.ru/Rus/DETI2/smekhova.html

... О проекте . ... A source of medical x-?rays based on a 50 Mev storage ring and a quasi-?continues picosecond laser is considered. It is shown that such generator produces useful X-?ray flux with higher average power and higher efficiency than that of conventional X-?ray tubes. ...

Еще в разделе: (Показать все результаты (>8) - miles.sinp.msu.ru/ )

• A project of laser electron X-ray generator for scientific applications |