... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...

Еще в разделе: (Показать все результаты (>10) - bioinf.fbb.msu.ru/ )

• Prot-DNA-Korr: main page
• SDPlight
• SDPsite

... Microporosity of porous glasses: new investigation techniques . Glass Physics and Chemistry, 2003, v.29 (6), p. 540-546 (2003) . ... Two new methods are developed for investigating the microporosity of porous materials. The first method, namely, diffusion diagnostics, is based on a computer analysis of the kinetics of gas desorption from a porous material into high vacuum. In this method, the kinetics of gas desorption is measured using mass spectrometry. ...

Еще в разделе: (Показать все результаты (>35) - www.kge.msu.ru/ )

• SMC Research Group Home Page. Moscow University.
• Дипломные работы
• RightMark Memory Analyzer

Описание вакансии: . Company: Bekaert NV, Zwevegem, Belgium . ... Reporting to/hierarchy: Corporate Technology Manager . Function details: This person will use his/her filtration expertise for the improvement of metal fiber based filter products and processes in close collaboration with the Product Market Managers and Technology Managers of the Business Units. ... He/she will take the necessary actions for the introduction of new applications for Bekaert liquid and gas filters. ...

Еще в разделе: (Показать все результаты (>33) - www.chemport.ru/ )

• HYDRANALR Buffer Base - компании-поставщики этого химического реактива
• Fundamentals of Bioorganic Chemistry. Textbook for medical students /
• "Phd student in the institute of physical chemistry in warsaw" - вакансия в

... Voronin А. Каrmanov D. Savin А. Electronic engineer: . ... Engineer ? ... Electrical design of microprocessor systems, creating software for control and monitoring earth and satellite stations. ... Programming, electrical and layout design of test equipment for testing the silicon matrix for experiment ATIC (Advanced Thin Ionization Calorimeter), creating software for calibration. Electrical design of readout electronics, creating software for collecting and analysis data for experiment NUCLEON . ...

Еще в разделе: (Показать все результаты (>30) - silab.sinp.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

звоните, мы в Москве(926)6667253 art-sale@mail.ru . Начало www.99ru.ru Виниловые пластинки Запад 15665 . ... Художественные . ... Этнография Фольклор . ... Фольклор . ... СССР (после 1917) . ... СССР . ... ссср . ... Введите код товара из каталога. автор Manfred Mann's Earth Band . ... 15665 . Manfred Mann's Earth Band . ... Западных уже нет, остались кое-какие лицензионные СССР звоните, тел.сверху . звоните по тел. 8926-6667253 и договоримся. ... Выбирайте, и звоните. ...

Еще в разделе: (Показать все результаты (>35) - www.bukivedi.ru/ )

• www.99ru.ru - Manfred Mann's Earth Band 15666
• www.99ru.ru - Manfred Mann's Earth Band 15667
• www.99ru.ru - Manfred Mann's Earth Band 15668

Применение моделирования для изучения качества воздушной среды на примере различных сценариев урбанизации. ... Рассматривается влияние будущей планировки, определяющей развитие городской инфраструктуры, на состояние окружающей среды. Обычно, когда исследуется будущее влияние роста мобильных источников загрязнения, моделируется увеличение пробега транспортных средств, как функция роста численности населения. ...

Еще в разделе: (Показать все результаты (>25) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=15&from=&ref_ind=0325004220
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=4&subtheme=13&from=0&ref_ind=0207000019
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=5&subtheme=22&from=&ref_ind=0412002142

... Объединенная геофизическая практика студентов кафедры физики Земли и кафедры физики атмосферы на Камчатке - лето 2015 года . ... Стараниями секретаря физико-математического факультета, а затем и помощника ректора Московского университета профессора Э. Е. Лейста в 1906 году на факультете была организована специальность физической географии и метеорологии, а кафедра физики преобразована в кафедру физики и физической географии. ... Заведующий кафедрой физики Земли академик В. А. Магницкий (1915-2005) ....

Еще в разделе: (Показать все результаты (>5) - geo.phys.msu.ru/ )

... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

Еще в разделе: (Показать все результаты (>2) - depni.sinp.msu.ru/ )

30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...

Еще в разделе: (Показать все результаты (>3) - cosrad.sinp.msu.ru/ )

. Schedule of lectures . Dr. Ivan Zassoursky . October 23 SUNY Brockport . October 25 SUNY Cortland . October 26 SUNY Geneseo . October 31 Skidmore College . November 8 SUNY Binghamton . November 14 SUNY Stony Brook . November 15 Columbia University . November 16 New York University . December 4 Kennan Institute . December 5 Georgetown University . December 6 George Washington University . December 7 SUNY New Paltz . Back . suny-msu . designed by e|g .

Еще в разделе: (Показать все результаты (>27) - suny.msu.ru/ )

• Center on Russia and the United States :: SUNY Russian Programs

... A comparative study of thermodynamic for both natural and artificial RNA/DNA ­ protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA ­ protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf
• http://rnp-group.genebee.msu.su/pdfs/febsz.pdf

Заседание 320 (24 октября 2014 г., совместное заседание с семинаром механико-математического факультета 'Современные проблемы математики и механики') . ... B. Emek Abali (Технический Университет Берлина) Thermodynamically modeling of nonlinear rheological materials and a new energy-based approach to determine the corresponding material parameters. A thermodynamical system can be described by the field equations that are governed by the balance equations and the appropriate constitutive equations. ...

Еще в разделе: (Показать все результаты (>34) - shamolin2.imec.msu.ru/ )

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...

Еще в разделе: (Показать все результаты (>3) - dionis.sai.msu.ru/ )