... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Magnetospheric particles and radiation conditions . ... Scientific equipment . ... ELFIN-L . ... It consist of a Flux Gate Magnetometer (FGM), an Energetic Particle Detector for Electrons (EPDE), and an Energetic Proton Detector for Ions (EPDI). ... Energetic particles create a hazardous environment for satellites and humans in space and cause a number of satellite failures. ... Magnetospheric particles and radiation environment . ...

Еще в разделе: (Показать все результаты (>44) - lomonosov.sinp.msu.ru/ )

• IMISS-1 | Университетский спутник "Ломоносов"
• BDRG | Университетский спутник "Ломоносов"
• DEPRON | Университетский спутник "Ломоносов"

... Alexander Gusev, Sternberg Astronomical Institute . Andrei Tokovinin, National Optical Astronomy Observatory . ... Antonia M. Varela, Instituto de Astrofisica de Canarias . ... Behnam Javanmardi, Shiraz University-Biruni Observatory . Boris Safonov, Sternberg Astronomical Institute . ... Davoud Afshari, Zanjan University . ... Florian Kerber, European Southern Observatory . Gianluca Lombardi, European Southern Observatory . ... Hiroshi Matsuo, National Astronomical Observatory of Japan . ...

Еще в разделе: (Показать все результаты (>213) - site2010.sai.msu.ru/ )

• Information

... Solver is implemented in CUDA Numerical Simulation of the Ice Moving in Strati ed Fluid PhD Degree Obtained in 2013 By using GPU we are able to perform computations with higher resolution which gives us an opportunity to study the interaction between sea ice and ocean in greater details Evgeny Mortikov, MSU Research Computing Center , researcher, evgeny.mortikov@gmail.com The project aims at determining the relevance of ocean strati cation for ...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• Internships at MSU | Moscow University Supercomputing Center
• APPLICATIONS: Plasma Physics | Moscow University Supercomputing Center
• Nationwide Supercomputing Education Project | Moscow University Supercomputing

... DEVELOPMENT OF EXPLICIT CYCLIC SCHEMES . WITH CHEBYSHEV?S POLYNOMIALS FOR SPACE NEUTRON KINETICS . ... Questions have been studied to use effectively explicit schemes for solving spatial kinetics. ... Algorithms have been developed to solve spatial kinetic equations on the basis of explicit cyclic schemes with time varying steps designed by V.I. Lebedev [1] as well as schemes of local iterations proposed by O.V. Lokutsievskiy and V.O. Lokutsievskiy [2]. ... Code development. ...

Еще в разделе: (Показать все результаты (>82) - sp.cs.msu.ru/ )

• Темы докладов, курсовых и дипломных работ. 1998-1999 учебный год
• DVM-system. Installation guide. Version 3.30

... D. CHASHECHKIN ON INTERNAL WAVES (compiled by Bruno Voisin on 12 October 2007) Emission of linear lee waves Three-dimensional waves from a sphere Makarov, S. A. & Chashechkin, Yu. D. (1981) Apparent internal waves in a fluid with exponential density distribution. ... Transl. from Zh. ... Received 13 October 1980. ... D. (1998) Localized and volume internal waves in a stratified fluid contiguous to a mixed layer. ... V. (1998) Monochromatic internal waves in an arbitrarily stratified viscous fluid. ...

Еще в разделе: (Показать все результаты (>12) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/pubs/Chashechkin-All.pdf

... Also during this work Dian drank a lot of tea with sugar, completed his description of urban and rural life (to the tunes of world-known musical "Notre-Dame de Paris"), wrote several poems about his dear friend GVR. ... Besides this project, Sergei A. Spirin with his colleague Andrew V. Alexeevski takes a very great part in different researches. Near their work room on the 3rd floor of the "A" laboratory building, near with the biological one, different colourful posters can be watched. ...

Еще в разделе: (Показать все результаты (>764) - monkey.belozersky.msu.ru/ )

• About this project

... help . find changesets by author, revision, files, or words in the commit message hg bisect [-gbsr] [-U] [-c CMD] [REV] subdivision search of changesets This command helps to find changesets which introduce problems. To use, mark the earliest changeset you know exhibits the problem as bad, then mark the latest changeset which is free from the problem as good. ... As a shortcut, you can also use the revision argument to mark a revision as good or bad without checking it out first. ...

Еще в разделе: (Показать все результаты (>389) - kodomo.cmm.msu.ru/ )

• TracModWSGI тАУ Tanchiki
• Department of animal cell biochemistry - Research and Projects
• Research

... help . find changesets by author, revision, files, or words in the commit message hg bisect [-gbsr] [-U] [-c CMD] [REV] subdivision search of changesets This command helps to find changesets which introduce problems. To use, mark the earliest changeset you know exhibits the problem as bad, then mark the latest changeset which is free from the problem as good. ... As a shortcut, you can also use the revision argument to mark a revision as good or bad without checking it out first. ...

Еще в разделе: (Показать все результаты (>1292) - kodomo.fbb.msu.ru/ )

• allpy: log
• allpy: 9adbec7c3366 sandbox/gl.py
• allpy: 9adbec7c3366 test/test.py

... Руководитель семинара профессор Ю. С. Владимиров . Семинар Российского гравитационного общества , посвященный обсуждению актуальных проблем теории гравитации, а также проблем соотношения геометрии и физики. Первоначальное название семинара: 'Гравитация и микромир' (орган кафедры теоретической физики физического факультета МГУ и секции гравитации НТС министерства ВиССО СССР). ... Официальным научным руководителем большого семинара считался председатель секции гравитации профессор А. А. Соколов. ...

Еще в разделе: (Показать все результаты (>5) - theorphys.phys.msu.ru/ )

• Междисциплинарный семинар 'Метафизика'
• Kirill A. Kazakov

Evolution of the double neutron star merging rate and the cosmological origin of Gamma-ray burst sources " , Astroph.J., 1995, v.454, 593-596 (Lipunov, V.M. Postnov, K.A. and Prokhorov M.E.) . Evolution of SupernovaЃExplosion Rates in theЃ Universe (Jorgensen H., Lipunov.M., Panchenko I.E., Postnov K.A., Prokhorov M.E.) ApJ, 1997, v.486,p.110 . ... Formation of a Gravitationally Bound Object after Binary Neutron Star Merging and GRB phenomena " (G.V.Lipunova, V.M.Lipunov). ...

Еще в разделе: (Показать все результаты (>18) - observ.pereplet.ru/ )

• MASTER GLOBAL ROBOTIC TELESCOPES NET
• MASTER ROBOTIC TELESCOPES NET

Service . Analytical Laboratory Provides Service In The Field Of . Applied Statistics. Training in applied statistics and in statistical software tools usage. Formalization of practical problems and solution algorithms choosing. Applied statistical problems solving, using Your data. ... Consultations on choosing of Russian and American software tools for applied statistical problems. Phone/Fax: (095) 939-5306 . e-mail: makarov@makarov.msu.ru . ... Fax . ... InCo . ...

Еще в разделе: (Показать все результаты (>6) - statsoft.msu.ru/ )

... Начало www.99ru.ru Страны и континенты Балканы 1159 . ... Введите код товара из каталога. автор PRIJATELJ, KRUNO . Хорватия Dalmatian Painting of the 14th to the 20th centuries . ... Summary: In the project "Selected questions of Dalmatian painting of the 14th to the 20th centuries" research was carried out on numerous not studied or not enough examined questions of the history of painting in Dalmatia in the cited course of time. The paintings from the 14th century were the oldest studied. ...

Еще в разделе: (Показать все результаты (>6) - www.bukivedi.ru/ )

Search of Novel Crystalline Materials , Study of their Properties and Crystallization Processes . ... The work of group for the search of novel crystalline materials are held at M.V. Lomonosov Moscow State University since 1964. The main aim of investigations are search and study of new promising multifunctional materials with unusual physical properties: ferroelectrics, superionic conductors, nonlinear optical materials, laser crystals, piezoelectrics, etc. ...

Еще в разделе: (Показать все результаты (>4) - newcryst.phys.msu.ru/ )

• Поиск новых кристаллических материалов, исследование их свойств и процессов

Lomonosov Moscow State University . ... Academic Programs . ... The faculty also issues a quarterly scientific publication "Moscow State University Bulletin. ... It maintains regular scientific and academic contacts with many Russian universities, takes part in joint researches, provides assistance in training highly qualified teachers. ... Faculty teachers and professors gained Russian and foreign awards, honorary titles and Russian and international academic prizes for their scientific achievements. ...

Еще в разделе: (Показать все результаты (>142) - ffl.msu.ru/ )

• About Us
• International Students

... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...

Еще в разделе: (Показать все результаты (>7) - ccoe.msu.ru/ )

Mechmath admission for internetional students . Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mathematics and Mechanics Faculty was created 1 May 1933 with a recovery of the faculty system inљ Lomonosov MSU . ... The faculty prepares high level experts of wide areas of Mathematics, Mechanics and Applying Mathematics , possessing theoretical knowledge and a technique of scientific experiment . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>17) - pk.math.msu.ru/ )

• Mechmath admission for internetional students
• IX Festival of Science | Mechmath admission for internetional students
• The Open Day | Mechmath admission for internetional students

SEISMIC DATA INTERPRETATIO N Graduate program "Applied Tectonics and Dynamic&Structural Geology" is intended for advanced studies in the classical chapters of Tectonics TECTONICS AND GEOLOGICAL and used to solve applied geological problems. All major areas, such as ANALYSIS FOR EXPLORATION Tectonics, Structural Geology, Geological Interpretation of the Geophysical Data and practical approaches for applied geological analysis, are covered by this graduate program. ...

Еще в разделе: (Показать все результаты (>28) - dynamo.geol.msu.ru/ )

• Publications of V.Zakharov
• Summaries of articles

DNS Security, Stability and Resiliency John Crain Chief Technical Officer April 21st 2009 Garmisch 1 Monday, 20 April 2009 Agenda · The Global DNS SSR Symposium · Problems and Opportunities · Questions? ... The level of awareness with respect to the DNS is very low" ­ All quotes from Symposium Report 7 Monday, 20 April 2009 Problems & Opportunities 8 Monday, 20 April 2009 Problem: · There is a need for training across all sectors of the industry to raise both skills and awareness. ...

Еще в разделе: (Показать все результаты (>18) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2009/gorokhov_eng.doc
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/global_dns.pdf
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/malisevic.doc

... Under physiological conditions, nucleoside diphosphate kinase (EC 2.7.4.6, NDPK) catalyzes the reactions of nucleoside triphosphates synthesis from ATP and the respective nucleoside diphosphates. ... During the last years, we have studied properties and functions of NDPK in the outer compartment of rat liver mitochondria. ... Why did we decide to study NDPK of the outer compartment of rat liver mitochondria? ... T.Y. Lipskaya (2001) Biochemistry (Mosc), 66, 115 - 129. ...

Еще в разделе: (Показать все результаты (>26) - biochem.bio.msu.ru/ )

• Sulfated and sulfonated polymers are able to solubilize efficiently the protein
• Biochemistry Department of Moscow State University | About us
• Biochemistry Department of Moscow State University | Conferences