... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

SEMINAR Singular Perturbations and Time Scales (SPaTS) in Control Theory and Applications 14:30 PM, Saturday, June 23, 2012, Room 5-18 Faculty of Physics, M.V. Lomonosov Moscow State University , Moscow, Russia Professor D. Subbaram Naidu , PhD, PE, Fellow IEEE Director and Professor, School of Engineering Director, Measurement and Control Engineering Research Center Idaho State ...

Еще в разделе: (Показать все результаты (>10) - matematika.phys.msu.ru/ )

• Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Научная

... Improvement of Java type compiler using in language independent remote process calls in KBase project. 09/2011 ­ present: Moscow State University, Dept. of Bioengineering and Bioinformatics (Russia) Scientific Research Java developer and lecturer Enhanced the CAMPS web resource (http://webclu.bio.wzw.tum.de/CAMPS2.0/) that enables multiple classification of transmembrane proteins. ... Developed web based UI for visualization of a graph of transmembrane protein families. ... Sutormin RA, Mironov AA. ...

Еще в разделе: (Показать все результаты (>11) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2014.pdf

... Supervisor/Institute |Topic | Prof. Dr.-Ing. Matthias Kind |Characterisation and | Phone: +49 (0)721 608-2390 |utilization of thin films | E-mail: matthias.kind@tvt.uni-karlsruhe.de | Dr.-Ing. ... Phone: +49 721 608-3765 |of products | ... Phone: +49-(0)721/608-2404 |Mechanical separation | Fax: +49-(0)721/608-2403 |processes | ... Phone: +49 (0)721/608 2580 | ... Phone: +49 (0)721/ 608 2570 |in combustion chambers and | Fax: +49 (0)721/ 608 7770 |online-control | ...

Еще в разделе: (Показать все результаты (>1285) - www.geogr.msu.ru/ )

• http://www.geogr.msu.ru/science/projects/our/ross_swed/NewsLETTER/7_8_11.pdf
• Конференция IGU
• CONTENT 3 (7) 2014

Apache Tutorial: Introduction to Server Side Includes . ... Basic SSI directives . ... SSI (Server Side Includes) are directives that are placed in HTML pages, and evaluated on the server while the pages are being served. ... You can tell Apache to parse any file with a particular file extension, such as .shtml , with the following directives: AddType text/html .shtml AddHandler server-parsed .shtml . ... XBitHack tells Apache to parse files for SSI directives if they have the execute bit set. ...

Еще в разделе: (Показать все результаты (>79) - neptun.sai.msu.ru/ )

• Environment Variables in Apache
• Apache directives
• Apache module mod_cgi

... Data . ... Bartels rotation number . ... Field Vector [Degrees (GSE coords)] . ... sigma|B| [RMS Standard Deviation in average magnitude (word 10), nT] . ... Proton temperature [Degrees, K] . ... R [sunspot number] . ... Proton flux [number/cmsq sec sr >1MeV] . Proton flux [number/cmsq sec sr >2MeV] . Proton flux [number/cmsq sec sr >4MeV] . Proton flux [number/cmsq sec sr >10MeV] . Proton flux [number/cmsq sec sr >30MeV] . Proton flux [number/cmsq sec sr >60MeV] . ...

Еще в разделе: (Показать все результаты (>69) - smdc.sinp.msu.ru/ )

• Space Monitoring Data Center
• Coronas-I - Space monitoring data center
• Space monitoring data center

Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>3) - seyranian.imec.msu.ru/ )

Заседание 320 (24 октября 2014 г., совместное заседание с семинаром механико-математического факультета 'Современные проблемы математики и механики') . ... B. Emek Abali (Технический Университет Берлина) Thermodynamically modeling of nonlinear rheological materials and a new energy-based approach to determine the corresponding material parameters. A thermodynamical system can be described by the field equations that are governed by the balance equations and the appropriate constitutive equations. ...

Еще в разделе: (Показать все результаты (>35) - shamolin2.imec.msu.ru/ )

Sergey Vladimirovich Petrushanko Afflilation and official address: Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow State University Leninskiye Gory, Moscow 119991, Russia E-mail: sergeant@mail.cern.ch Date and place of Birth: 24 March 1975, Sverdlovsk (USSR) Citizenship: Russian Federation Education: 2002 Ph.D. (High energy physics ) Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow ...

Еще в разделе: (Показать все результаты (>57) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/rdmscms/reglist.html
• http://lav01.sinp.msu.ru/~vlk/CONF3_report.ps
• http://lav01.sinp.msu.ru/nir/papers/NIM_3000-LGD.pdf

... for Food Security . Home Events Online Consultation on Network and Partnerships.. ... This discussion will serve as a preparatory stage for the upcoming International Conference on International Conference on Eurasian Food Security and Nutrition Network and Eurasian Soil Partnership to be held in Bishkek, February 29-March 2, 2016. ... Topic 1: Building the Eurasian Food Security Network . ... International Forum on Eurasian Food Security and Nutrition Network and Eurasian Soil Partnership read . ...

Еще в разделе: (Показать все результаты (>17) - ecfs.msu.ru/ )

• Communication and Information Department | ECFS
• The Department of land resources | ECFS
• About Eurasian Center for Food Security | ECFS

... Bachelor Program . Master Program . ... The Department of Operations Research . ... researchers specialized in mathematical models and methods of economic regulations . ... possess a profound knowledge in the field of e со nometrics, risk theory, actuarial and financial mathematics, the theory of games, operations research, economic regulation on micro and macro levels . ... can use modern computer technologies in order to construct models and solve optimization problems . ... exam . ... test . ...

Еще в разделе: (Показать все результаты (>18) - io.cmc.msu.ru/ )

... Further tests of the radiocarbon method of age determination (1 3, 6, 8,1 0) for archaeological and geological samples have been completed. All the samples used were wood dated quite accurately by accepted methods. ... TABLE 1 Age Determinations on Samples of Known Age . ... Specific activities for samples of known age. ... The former sample was cypress wood and the latter acacia. ... This committee advised us what samples of known age to use for testing and greatly assisted us in procuring them. ...

Еще в разделе: (Показать все результаты (>100) - hbar.phys.msu.ru/ )

• njudge.htm

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>6) - lvk.cs.msu.su/ )