Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>6) - compmech.math.msu.su/ )

• Список публикаций - А. Н. Козлова - Кафедра вычислительной механики

... David Kirk/NVIDIA and Wen-mei W. Hwu , 2007-2012 ECE408/CS483, University of Illinois , Urbana-Champaign 14 CUDA Device Memory Management API functions · cudaMalloc() ­ Allocates object in the device global memory ­ Two parameters · Address of a pointer to the allocated object · Size of of allocated object in terms of bytes ( Device ) Grid Block (0, 0) Block (0, 1) Registers Registers Registers Registers · cudaFree() ­ Frees object from ...

Еще в разделе: (Показать все результаты (>6) - ccoe.msu.ru/ )

• http://ccoe.msu.ru/sites/default/files/presentations/Moscow-Keynote-Hwu-10-22-2012.pdf
• http://ccoe.msu.ru/sites/default/files/RU_Apps_Catalog_Sep13_LR.pdf

Skip to main content . ... ECFS . ... Форум Евразийского почвенного партнерства Forum . Евразийский центр по продовольственной безопасности МГУ рад приветствовать вас на странице Форума Евразийского почвенного партнерства. Skip courses . Skip course categories . Search courses: . Skip новости сайта . ... Skip Main menu . Сайт Евразийского центра по продовольственной безопасности . ... info@ecfs.msu.ru ...

Еще в разделе: (Показать все результаты (>2) - edu.ecfs.msu.ru/ )

• ECFS: Сайт Евразийского центра по продовольственной безопасности

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

SPAW Editor PHP Edition version 1.0.6 Release Notes Thanks to everyone who downloaded, tried and supported SPAW Editor! This release includes several new features: css classes for tables, background images in tables and table cells, improved link dialog and more. ... If you are fluent in any of languages that are now included and see any typos or mistakes please report to spaw@solmetra.com Happy editing, Alan Mendelevich a.k.a. ailon alan@solmetra.com ...

Еще в разделе: (Показать все результаты (>3) - textbook.sinp.msu.ru/ )

... Разработка и внедрение образовательных программ повышения квалификации специалистов в области инновационной деятельности . ... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 27 марта 2016 года Московский государственный университет имени М.В.Ломоносова приглашает на весенний ДЕНЬ ОТКРЫТЫХ ДВЕРЕЙ . ... New technologies in gas chemistry . ...

Еще в разделе: (Показать все результаты (>4) - www.hsib.msu.ru/ )

• Master Degree in Geology | Высшая школа инновационного бизнеса МГУ

... NetCDF User's Guide for C . abnormal termination aborting define mode definitions access example of array section other software for scientific data random shared dataset [1] [2] access to netCDF distribution FTP WWW adding attributes [1] [2] dimensions [1] [2] variables [1] [2] add_offset attribute [1] [2] ancillary data [1] [2] APIs descriptions differences between C and C++ differences between C and FORTRAN summary of C appending data along unlimited dimension to dataset ...

Еще в разделе: (Показать все результаты (>40) - angel.cs.msu.su/ )

• Foreword
• PhD Summer School on Scentific Computing
• Serialized Form

... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...

Еще в разделе: (Показать все результаты (>11) - belyakov.imec.msu.ru/ )

... Fluorescence induction curves registered from individual microalgae cenobiums in the process of population growth. ... Registration of chlorophyll fluorescence induction curves (IC) from individual microalgae cenobiums was performed during Scenedesmus quadricauda culture growth. ... Recording of the fluorescence induction curve for each individual cenobium was performed during 200 s. In the process of algae cultivation (52 days) 846 fluorescence kinetic curves were recorded. ...

Еще в разделе: (Показать все результаты (>30) - www.library.biophys.msu.ru/ )

• ВЫБОР ОПТИМАЛЬНОГО АЛГОРИТМА ДЛЯ ОБРАБОТКИ ДАННЫХ ФЛУОРЕСЦЕНТНОЙ КОРРЕЛЯЦИОННОЙ

... Meeting at the Russian Union of Rectors International Conference on the Arctic WWF calls to protect the Arctic The President signs law on radioactive waste The problems of Lake Baikal Cleaning of Russia 's Arctic zone Moscow is expanding Moscow goes for selective waste collection Protected areas on land being connected to Moscow Discussion of Moscow 's program for Environmental Protection New protected ... Source: Russian Prime Minister V. Putin's site. ...

Еще в разделе: (Показать все результаты (>313) - www.geogr.msu.ru/ )

• Instructions for Authors, contributing to “GEOGRAPHY, ENVIRONMENT,
• CONTENT 4 (8) 2015
• CONTENT 2а(5)а2012

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>5) - www.eng.geogr.msu.ru/ )

• Selenga-Baikal research

Announcement On November 2-3, 2005 Lomonosov Moscow State University will conduct jointly with the Academy of Cryptography of the Russian Federation the Fourth All- Russian Conference Mathematics and Security of Information Technologies [Cybersecurity?] and jointly with the Center of International Studies, Cambridge University , United Kingdom, Advanced Research Workshop Unconventional ... Sherstyuk V.P. - Security Council of the Russian Federation; 3. ... Organization Committee 1. ...

Еще в разделе: (Показать все результаты (>14) - suny.msu.ru/ )

• http://suny.msu.ru/ru/ProgramMaBIT05En.doc
• Center on Russia and the United States :: Other Russian Programs

Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia e­mail: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the so­called V­ Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY Y­MP supercomputers. al structure of the program. ...

Еще в разделе: (Показать все результаты (>7) - asa.guru.ru/ )

• Alexander Antonov's Resume

... Sklyar V., Gladchenko M., Kurakova O., Shcherbakov S., Kalyuzhnyi S. UASB treatment of wine distillery wastewaters under mesophilic and submesophilic conditions. ... Kalyuzhnyi S.V., Gladchenko M.A., Sklyar V.I., Kurakova O.V., Shcherbakov S.S. The UASB treatment of winery wastewater under submesophilic and psychrophilic conditions. ... Wat. ... Kalyuzhnyi S.V., Gladchenko M.A., Sklyar V.I., Kizimenko Ye.S., Shcherbakov S.S. (2001) One- and two-stage UASB pretreatment of winery wastewater at 4-10 oC...

Еще в разделе: (Показать все результаты (>131) - www.enzyme.chem.msu.ru/ )

• Biochemistry
• On-line registration
• products

XXIII ICTAM, 19­24 August 2012, Beijing, China CASES OF INTEGRABILITY IN DYNAMICS OF A RIGID BODY INTERACTING WITH A RESISTANT MEDIUM Maxim V. Shamolin Institute of Mechanics, Lomonosov Moscow State University, Moscow, 119899, Russian Federation Summary The author discovers new integrable cases of the rigid body motion in a resisting medium, including those in the classical problem of motion of a spherical pendulum placed in the over-running medium flow. ...

Еще в разделе: (Показать все результаты (>44) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-136-1.pdf
• http://shamolin2.imec.msu.ru/art-134-1.pdf
• Mathematical Reviews

Поиск по МГУ | Лента новостей | ... McKinsey & Company Business technology office. ... Grant program of McKinsey Company Business technology office . ... McKinsey Company . ... McKinsey Business Technology helps clients harness the transformative power of technology to create business value for today, and step-function growth for tomorrow. ... Your motivation letter should tell us: 1) what interests you in Business Technology; 2) what will You bring to McKinsey s Business Technology office. ...

Еще в разделе: (Показать все результаты (>57) - www.msunews.ru/ )

• MsuNews.Ru | Новости МГУ | Выпускник мехмата МГУ выиграл Хакерскую премию

Marketing Plan Outline Canada Business Service Centres - CBSCs Last Verified: 2004-11-08 Document No. 4014 Summary A marketing plan is designed to direct company activities towards the satisfaction of customer needs; determine what the customer wants, develop a product/service to meet those needs, get the product/service to the end user and communicate with the customer - at a profit! ... levels, sales volumes? ... What is the consumer acceptance price range for this type of product/service? ...

Еще в разделе: (Показать все результаты (>31) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc
• http://www.innovation.msu.ru/english/neuromotioncasestudy.doc
• http://www.innovation.msu.ru/english/yourmarketingstrategy.doc

... What is the author's opinion on the problem? ... Organize the following parameters into 3 groups: content, organization, presentation (performance) · Body-language and eye contact · Fluency · Proper intonation and pronunciation · Relevant information and examples provided · Conclusion · Key concepts explained\defined · A range of complex grammatical structures and academic vocabulary · Key points emphasized · Introduction · Various linking devices, the transition from one point to the ...

Еще в разделе: (Показать все результаты (>25) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/theses1.pdf
• http://www.eng.math.msu.su/download/The_Day_The_World_Changed_article_and_vocabulary.pdf
• http://www.eng.math.msu.su/download/theses3.pdf

... Master . ... SAI MSU . Conference was supported by PLC "MO "OPTIKA" . ... Morning session . Chair Hugo Levato (ICATE, Argentina) . ... Vladimir Lipunov ( MSU , SAI ) . ... Evgeniy Gorbovskoy (MSU, SAI) & . А lexander Belinskiy (MSU, SAI) . ... Chair Claudio Mallamaci (OAFA, Argentina) . ... Using MASTER Net in the MSU educational process . ... Chair Victor Kornilov (MSU, SAI) . ... Nikolay Budnev (ISU ) . ... Excursion to the Moscow Kremlin . ... Joint MASTER and Russian Pereplet session. ...

Еще в разделе: (Показать все результаты (>48) - master.sai.msu.ru/ )

• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists
• YaB-100 - Participants
• International Workshop ?Robotic observatories?

List of Publications Elena A. Kudryavtseva March 2007 1. Gerver, M. L. and Kudryavtseva, E. A. (1995): A theorem on precedence relations generated by completely positive kernels. ... Russian Math. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2001): Intersection index of curves on surfaces and applications to quadratic equations in free groups. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2002): Ro ots of mappings on nonorientable surfaces and equations in free groups. ...

Еще в разделе: (Показать все результаты (>64) - dfgm.math.msu.su/ )

• http://dfgm.math.msu.su/files/skopenkov/publist.pdf
• http://dfgm.math.msu.su/files/koudr/publ3eng.pdf
• http://dfgm.math.msu.su/files/papers-sym/0503389v1.pdf