The Application and Characterisation of Nickel Nanoparticles Inside the Mesopores of MCM-41 Dennis J. Lensveld, J. Gerbrand Mesu, A. Jos van Dillen and Krijn P. de Jong Introduction The recent development of several structured mesoporous materials has received much attention from the field of catalysis. ... However, stability limitations of MCM-41 and related materials call for dedicated catalyst synthesis procedures. ... As a reference precursor the commonly used nickel nitrate was used. ...

Еще в разделе: (Показать все результаты (>22) - www.kge.msu.ru/ )

• Scientific equipment of laboratory
• Archive
• ЛОКТЕВА ЕКАТЕРИНА СЕРГЕЕВНА

... Measurement of the MASS detectors parameters with mass program January 24, 2015 [112707] . MASS/DIMM electronics. ... Turbina-core(D): Dimm User Guide. ... N.Shatsky, V.Kornilov, The revision of the MASS/DIMM star catalogue. ... О.Возякова, В.Корнилов, Н.Шатский, Новое программное обеспечение прибора MASS/DIMM. ... V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site. ...

Еще в разделе: (Показать все результаты (>21) - curl.sai.msu.ru/ )

. dpidb:// home / help . DNA-Protein Ineraction DataBase home page . DPIDB contact page . This help page . Under construction! . DPIDB . Last modified: April 2, 2001 . All material on this page is property of DPIDB project team. This page is best viewed at 800*600 resolution or above using a version 4 browser or newer.

Еще в разделе: (Показать все результаты (>22) - monkey.belozersky.msu.ru/ )

• DPIDB server information

. Uneex . MailingList . Printable . Новости . О нас . Семинары . Лекции . Рассылка . Контакты . Рассылка предназначена для обсуждения семинара, прошедших и планирующихся докладов, а также любых тем, связанных с UNИX. Относитесь к собеседникам с уважением -- и они ответят вам тем же. Все сразу. https://imap.cs.msu.su/mailman/listinfo/uneex . Copyright 2003 by the contributing authors. All material on this site is the property of the contributing authors. Send feedback to svv at cmc dot msu dot ru.

Еще в разделе: (Показать все результаты (>42) - uneex.cs.msu.su/ )

• Uneex . FrBrGeorge
• TWiki . Uneex . FrBrGeorge
• TWiki . Uneex . HowToFind

... О UNИX . ... GnumericDoc_ru . Неизменяемая страница . ... Другие действия: Показать разметку Вид для печати Сформатировать как Docbook Очистить кэш страницы ------------------------ Проверить правописание Похожие страницы Карта окрестностей ------------------------ Переименовать страницу Удалить страницу ------------------------ Подписать пользователя ------------------------ Очистить от спама Вернуть эту версию Страницы пакета Синхронизировать страницы ------------------------ ...

Еще в разделе: (Показать все результаты (>97) - uneex.mithril.cs.msu.su/ )

• HelpOnInstalling/InternetInformationServer - UNИX
• HelpOnConfiguration/IntegratingWithApache - UNИX
• HelpOnInstalling/StandaloneServer - UNИX

... Преподаватели ВШБ МГУ Сергей Заверский и Наталья Чуркина выступили на международной конференции 'The Social Economy. Corporate Responsibility, Private Property Partnerships, Workers' Rights and Cooperatives' в Испании. ... Преподаватели ВШБ выступили с презентацией доклада Business Response to Environmental Challenges: Three Cases of Russian Companies на секции Corporate Social Responsibility and the Environment . ...

Еще в разделе: (Показать все результаты (>70) - www.mgubs.ru/ )

• Мастер-класс Глена Курокавы
• Высшая школа бизнеса МГУ им. Ломоносова

... Yu.P.Kudryavtsev, M.B.Guseva, V.G.Babaev, 'Oriented carbyne layers', Carbon, 1992, v.30, N2, p.213-221. В.Г.Бабаев, М.Б.Гусева, Н.Ф.Савченко, Н.Д.Новиков В.В.Хвостов, П.Флад, 'Высокоориентированные пленки sp1 углерода', Поверхность, ?3, 2004, с.16-27. ... Новая фаза углерода с ГЦК-структурой',Поверхность, ?3, 2004, с.28-35. ... Бабаев В.Г., Хвостов В.В., Гусева М.Б., Савченко Н.Ф., Белоконева Ю., 'Высокоэффективный холодный катод на основе углеродного волокна', Поверхность, ?5, с.89-96, 2007 ...

Еще в разделе: (Показать все результаты (>6) - physelec.phys.msu.ru/ )

A full system of equilibrium differential equations for the finite number of suspension lines (n = 28) of square parachute is derived. ... One can determine the shapes of inflated canopy radial cross-sections, stress distribution of radial ribbons on the canopy surface and fabric stress between them, drag coefficients for various line lengths and air-permeability by means of computer simulation. ... Initially, this problem was solved assuming D p = const over total canopy of square parachute. ...

Еще в разделе: (Показать все результаты (>8) - margaret.imec.msu.ru/ )

• Large-Scale Load Stabilization

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

... Программы обучения . ... Пропустить категории курсов . ... Пропустить новости . ... от Администратор ЦДО Ф/Ф МГУ - Понедельник 4 Август 2014, 09:53 . 04 августа 2014 года в Интеллектуальном центре ? ... Российские ВУЗы все чаще переходят на дистанционное обучение . ... ДИСТАНЦИОННЫЕ ПОДГОТОВИТЕЛЬНЫЕ КУРСЫ ФИЗИЧЕСКОГО ФАКУЛЬТЕТА МГУ ПО ФИЗИКЕ И МАТЕМАТИКЕ Пропустить Страницы ЦДО в социальных сетях . ... Центр дистанционного образвания физического факультета МГУ им. М.В. Ломоносова 2007-2012 . ...

Еще в разделе: (Показать все результаты (>53549) - distant.phys.msu.ru/ )

... Выпускники . ... Женский клуб . ... Издательство МГУ . ... The correct theoretical analysis of the generally accepted foundations of theoretical physics is proposed. ... The main result is as follows: the foundations (i.e. classical thermodynamics, the special theory of relativity, quantum mechanics) contain logical errors The existence of logical errors is irrefutable proof of incorrectness of the theoretical foundations and means that theoretical physics enters the greatest crisis. ...

Еще в разделе: (Показать все результаты (>319) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "CRISIS IN THEORETICAL PHYSICS: THE
• Клуб выпускников МГУ: Торонто привлекает мировых инвесторов в недвижимость
• Клуб выпускников МГУ: Конференция "Выпускники МГУ в США"

. В открывшемся окне Mail Server Properties укажите требуемые настройки. Не забудьте про флажок, включающий SSL. Back Next .

Еще в разделе: (Показать все результаты (>3) - oldmail.cs.msu.su/ )

• Настройка Thunderbird / Mozilla Mail для получения факультетской почты

... This article caused a most lively interest from the readers, and received more than a hundred responses, which contained various versions of construction methods of the Sri Yantra. ... In this way he revealed a good correspondence between the concentric levels built by him in this relationship of the three Sri Yantra and the orbits of the planets of the solar system (Fig. 10, shows the first two out of three stars examined by him) with a divergence from the real diameters of orbits of about 1.5%. ...

Еще в разделе: (Показать все результаты (>11) - www.protein.bio.msu.ru/ )

• CONAN-m

Faculty of Physics of Lomonosov Moscow State University . ... Department of Photonics and Microwave Physics is one of the largest departments of Faculty of Physics of Lomonosov Moscow State University . ... Our department holds annual conference on wave phenomena in nonhomogeneous media, physics and applications of microwaves in May in Moscow suburb. ... Physics of microwaves . ... Department of Photonics and Microwave Physics . Faculty of Physics . Lomonosov Moscow State University . ...

175. 5-th All-Russian Conference "Nitrides of gallium, indium and aluminum:

176. http://sn.sai.msu.ru/~sil/preprints/postbr2.pdf

177. http://www.library.biophys.msu.ru/PDF/80524.pdf

178. http://www.fbm.msu.ru/sci/conf/2013/mio/infletter-e.pdf

179. Мейчик Наталия Робертовна

180. Invited speakers