THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Gas Sensors Laboratory (SENSOR) , Department of Chemistry and Physics for Engineering and for Materials , University of Brescia , Italy: Prof. Giorgio Sberveglieri, Guido Faglia, Maurizio Artoni, Camilla Baratto, Dario Zappa. Lab contact Prof. Alexander Gaskov. ... Laboratory contact person: Dr. S.G. Dorofeev . ... 2008-2010 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>12) - www.lssm.inorg.chem.msu.ru/ )

• Лаборатория химии и физики полупроводниковых и сенсорных материалов | Дирин

... Студенты МГУ им. Ломоносова едут в Лондон на финал CFA Institute Research Challenge . Результаты российского этапа международного студенческого конкурса CFA Institute Research Challenge подвела Ассоциация CFA (Россия). ... Студенты Московского государственного университета имени М.В. Ломоносова едут в Лондон на финал CFA Institute Research Challenge. ... Как уточняет пресс-служба CFA в России, Institute Research Challenge - международный студенческий конкурс по финансовому анализу. ...

Еще в разделе: (Показать все результаты (>105) - www.msunews.ru/ )

• MsuNews.Ru | Новости МГУ

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... The 6th Moscow International Conference on Operation Research (ORM-2010) was held on 19-23 of October 2010 in Moscow. ORM is a triennal conference organized by Dorodnicyn Computing Center of the Russian Academy of Sciences (RAS), Lomonosov Moscow State University and Russian Scientific Operation Research Society. ... A. Vasin was optimistic about the further integration of the Russian of the Russian OR community as he himself is already actively involved in conferences of GOR, EURO and IFORS. ...

Еще в разделе: (Показать все результаты (>15) - io.cmc.msu.ru/ )

... Issues of the year 2012 . ... Russia, National Research Belgorod State University; 308015, Belgorod, Pobeda St. 85 . E-mail: Chendev@bsu.edu.ru . ... SOILS AS INDICATORS OF CLIMATIC CHANGES Abstract: . ... Key words: chernozems, climate change, Holocene, forest-steppe, steppe . ... Phone: +7-495-624-7257 . ... LANDSCAPE METRICS FROM THE POINT OF VIEW OF MATHEMATICAL LANDSCAPE MORPHOLOGY Abstract: . ... Permafrost Laboratory, Institute of Environmental Geoscience, Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>268) - www.geogr.msu.ru/ )

• Editorial Board
• CONTENTS ? 3 - 2015
• Instructions for Authors, contributing to “GEOGRAPHY, ENVIRONMENT,

. [Russian] .. Education, . Research Interest . Scientific Achievements . My Teachers . Parachute Science . Parachute Equipment . Margarita Dzhalalova . Ph.D. (Phys.& Math.), Senior Research Scientist . Address: . Institute of Mechanics . M.V. Lomonosov Moscow State University . 1 Michurinsky pr. Moscow 119192, Russia . E-mail: . margarita-vd@mail.ru . Copyright & Design 2001 by M. Dzhalalova . М.B. Джалалова

Еще в разделе: (Показать все результаты (>4) - margaret.imec.msu.ru/ )

... 2015 . ... Professor emeritus, Trachtenberg School of Public Policy and Public Administration, George Washington University. ... This paper provides a critique of several of the key philosophical and psychological assumptions on which mainstream administrative ethics is typically based, followed by a discussion of four "counterintuitive" ethical propositions implied by that critique. ... Ethical guidance for public administrators, management, ethical discourse. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>187) - ee-journal.spa.msu.ru/ )

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... The Faculty of Journalism, Lomonosov Moscow State University has a long legacy of academic excellence, and we continue to build on that legacy in ways that prepare students to succeed as media professionals in a rapidly changing world. ... Thank you for your interest in the Faculty of Journalism. ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>52) - www.journ.msu.ru/ )

• About MSU :: Department of Journalism, M. V. Lomonosov Moscow State University
• Partners :: Department of Journalism, M. V. Lomonosov Moscow State University

Welcome to the site of the Laboratory of Mathematical Models of Quantum Scattering Processes . ... It develops mathematical models of ionizing collisions in atomic, molecular, and condensed matter physics. Main areas of current research activity include single and multiple ionization by electron, ion, and photon impact, ionization processes in strong laser pulses, and laser-assisted ionizing collisions. ... Research | ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>9) - lmmqsp.sinp.msu.ru/ )

CRIMEAN FIELD GEOLOGICAL CAMP, FIRST YEAR (1st CRIMEAN) . First Crimean Field Camp is organized for the MSU Geological Faculty first year students. ... Professors and researchers from Dynamic Geology Department of Geological Faculty and Russian Academy of Science Institute of Geology are leadind the students. ... SHORT HISTORY OF THE 1st CRIMEAN . ... The main goal of the field camp is to show students how geological processes work now and what we can learn about them in the past. ...

Еще в разделе: (Показать все результаты (>19) - dynamo.geol.msu.ru/ )

... Laboratory was organized in 1995. ... Electron microscopy (through the Dept. Of Electron Microscopy) - HU-11 and H-700 transmission electron microscopes; ultramicrotomes etc. ... Microscope station for UV-microirradiation (260-280 nm wavelength, diameter of the microbeam from 0.5 um) . ... Address : Department of Electron Microscopy, Belozersky Institute , Build. ... Moscow State University , Moscow,119992, Russia. Tel: +7(095)939-2084 . Fax: +7(095)939-2084 . ...

Еще в разделе: (Показать все результаты (>36) - cellmotility.genebee.msu.ru/ )

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

173. Quantum Information Lab, Int'l Laser Ctr. and Faculty of Physics, M.V.Lomonosov

174. http://mph.cs.msu.ru/mph/pap/txt/fedotov.doc

175. ВМиК - Online! : Интересно - Лекция Microsoft: Future Directions in Computer

176. http://www.iisi.msu.ru/UserFiles/File/bayern2010/sadowsky.doc

177. http://www.msm.biophys.msu.ru/archive/doc15016/eng.pdf

178. Center on Russia and the United States :: Currently available grants

179. Moscow Society of Naturalists

180. Background? Faculty of Bioengineering and Bioinformatics, MSU